Description :
From Genome Similarity Track
Location :
Scaffold_1:69987- 72059
Transcript NameFunction/comments
Physo_127027hypothetical protein

Sequence
2072 bases(100 bases per row)
CATCGACTCCCGGAGTCGACGGCGTTACGTCACCTTGGCTCTTATTATTGGCCAGACCTGATCCAATTAGATTCGCGTCAGCCTCCACGGCTGAGGCGTG
TGACTCGCCTGCGTCATCCGTGCCCCTTGAGGCCGGAGACTCTTCCTGATTCGCTGAAAATCGGGTATCGACCTCCGAGGTCAACACATTTTCTTCATTA
GCTGTCGGCGGCAACGCCGACGCTAGCTGCTCTTGCGCGCGTGCTCGCGCGGCCCCAGGGCGCTCCGGAACAGCAGCGTTAGGCGCTGTCTCGGTGGGGA
GTCGCACGCACCTGTCGGTGTGTGCGTAGCGGCAACAGGGCCATCGCTCACTGTTCCGAAGCGCACGAGAGTGCGCTTCTCCCAATCGATGACCGGATCA
TGCCGTGCAAGCCACGGCATGCCCAATACGATGTCAAACTTATCGTCCAGATCCAGGACGATAAAGGTCTCGACAAACTCTTGGTCTTCATACGTGAAGC
GCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACCTCCAGCATACTTCGAGGTATCTTTAAATCCTCGAAGTCAAGCCT
TGATAGACTTCGCAGTCGAACAAAGTTGTTCGACGCGCCCGAATCAACCAAAGCACGAAAAGATTTGCTCTCTCTCATCGAGTTCACGTTCAACATGAAA
AGGTTCGGTTTGTCATCATGCATTTTGCAGTGAGAAGGGTCCTCACTGGGGGCTGCAGTCCTCAGTTTCGCATGTCCGAGTTGGACATGCGTGACTGCTT
CACCAGTAGGGCGCCCCGCGCCTACTGGGTTCCAGCGTGTTTTGTTCGTTCGCGCCGATGCCCTGCATCGCCGCGTCGACCACCATCTCGGTGCACGGGT
GCCGTGTACTCTCGGGCAAAGTGACCGACTCTACCGCAACGGTAGCATCGCACATTGTTTCCCTGCAACTGCTGGGGTCCAGCAGTTGCAGCACTCGAGA
GGCCCGTGGGTAATGGGCCTCCCGTCCTCGCTACCGGGCGTGGCTGTGGCCTCGGCACATCTGCATGCAGTTTACCCTGCCGCAGGCTAAACTCCTCCTG
CATTGCAAGAGTAATCGCAGCTTCGAAAGTGCCTGGGTACTCACGGAAGAGATAGGTCTTTACAGGCCCATCTCTCAGTCCCTTCATGAACGTGACGACC
TTGGTCGCCTCGTCGATCGGATTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTCTGCGCGTACGCATGGACATCGTGCTTACCCTACTGTAGGTCGA
GTAACTCTGCCCTCGACCCAAACTCATTTTGCGGGGGCTCAAACGCTTGCCTGAGCTCCTCCTTGAAACCCTCGTACGTGCTGAAGCACGTAGGATCAGA
GAGTCGGCGTCCATACGCCCAACTTCTCGCTCGTCCGCCAAGGCATGACATGGCGAACGCAACCTTGGACAACGGGTCGACGATACGTCGAGCCGCGATG
GCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGTTTCACCCTCTCTTCCGACATAGTTGCTCACATTGAGCTTCAACGATTGCGCGCGTGGTGTCGCCC
CGGACGACACCGCGGTAGTAGCAGCAACATCGCGTTGCTCCTTCAGGATGAAACCCAGAGCAACACCGTGTTGCTCTGTCGGCGTTAGCGACGCAGCATC
GTAACTACAGCCGCCTCACCAATGACCGTTGAGGGAGGGGTGGGCACAGTCAGCGCGTGCAACGTGAGTTACAGGCGTAGTGGAGCTTTCCATGGGCACC
TCTGTATCCATGGGAATCAGCTCCACATATCCATGGGAATCAGCTCCGCGTTCATGCGGTGACGTACGAACTCAGGTAGTCGGTCGTTGGACGGACTACA
AAGTGCTACCAGGTGTAATGGGCCTGCTTTGGCTCACTACTTTAGCTTACACGTCTGCGCACGTGTGTGAGGAAGCGTAGCTTACTTTAAACGAGAGTTA
ATTATACTCGGGCCTCCGAGTATAGGTTAATCAAAATATACGATCCAAATAATGTTTTTGGGTTAAATCAGA