Description :
From Genome Similarity Track
Location :
Scaffold_10:699822- 703088
Sequence
3266 bases(100 bases per row)
GCTCTCATCATGTTTGTAAACTGTCTATCTGTGCGATATACAGCCGCCTCTGCTCCTTGTGCGTGATGTGCTAGCTTGCGTTGAGATTAACATTGCCGTT
CCGTTTGGAGATAAGCTTTGTGTTTAACGCTGCATTTAAATTCATGTTTGGAGCGTAACGAGGTTAGCTTTGCTGCTCCATTTGAAGGTTAAGCTTAGTG
CTCAATACTACCACTGTAAATCAATTACCTAGTGATTATTGAGCACGTAGTACACCATGTATTAGCTCCCTATGCCTTATCGTCTCTTATGCTTCCGTAT
TGCTCAGCGTGTTGTCTTCCACAGCCTCGTCTTCAATGAAGGGCTTGCGAACAAGTAGGCGGCGCTCCTTCTCAAAGACAGCGACAACGGTGCGGTTTTT
ATGTTTGCGCGCTCCCACGCTGCCTCCCACTCCACCAGGTAGTACGTTCTGCGGTTTTCGCGCTTCCAGATCAGCAGTTTGCGGGAGTAGTGCTGCTTCT
CACCCTCAAGCTTCTCTTTCGCGCTTCGATCGATCTCACTATCGGACAGATCATCGTCAGCAAAAGGAGGTACACGCCCCGCTTGAACGTCGTCGAGACT
GAAACGCGGCTTCTTTTTCTTGGCCGAGGAGAGATGATGACGTCGATGGCTTCAGGAAGTAGCGTCGGCGAGGCGATGGCCGTATTCGTGGTAAGGCGTA
GGTAACGGATGGCTTCATCACTAACCCGAATCTTGTAAAACTAGGATACAGAAACACACAGCTTTTTGAACTCTCTGGTCGAGTTGATGACAATCTTGAC
GGTTGCATGATGATTGGTTGGAGGTAGAAAGGAGAATAAGCGACATGATTGAAGGAATGAGTCGACAACTGTAATCAAATGACGGAACGACACGATTGAA
GGAATGAGTCGACTACTGTAATCAAATGACGGCGACGAGTAAACTCAGTGGTACGTAATTACGTAGTCGAAACTATATCTAGTATGTTTGTTGTGTGAGG
TGGAGCAGGGTCTTGTATGCAGCCTCCAACTTGAAGGCGCCTATAGCAGTTAATGTGATCGTTGAGGTGACCGTTCTTGTGGAGTTTGCGCATTGTCTTC
AGCACATTTTGAGCTTCGCGGGCTGTGATACCCCGCTCTTGTATTGGCGTTTCCTCTGCTCTGATTCCAAACCTGATGACCTCGTCTCTGGATTGTGGTG
ACTTCTCATTCAGAGCGAAGCCGTCCGAAAGGAACATTTTCATGAAGGCGACAGTCTGCTTGTTGGTTGAACGCACATGCTTGCTTGAAGTGTCCGTCGA
GCACCACAGATGCGGCTCTTGACGCATCGTTCAGCCTGACAGCATCAGAGGTACGGCGTCGCTTGACAGGTGGTGTGTTAGTATCTGCATCTTGACGCAT
CTCAATTGAGGTTCTTTTCTTTTTTTACTTGTTGTAGAACTAAGCCTCCATTACCGACAGACGTACGTCGAGCTTCTGTTTTACCTGAATTAGCTGATCA
ATTAGTGATGCTTGGTGAAGATACAGGGGGTGTTTGGTGAAATATGCTGTCGTTTCATGAGCAGCGGCGCCTTCTCTAGCGTCAGACAATATTGGGTCTC
GAGCCAAGTACGATGACCACGAGAGCAAGTCATTGCATGAGAGCCCTTTGGCTATGGTACATGATTCGATGCGCTGGATCACTGGACTATCTGACGCTAG
TGTCTTGAGCTGAGGGTAGTGTTTCAGCCGGTACGCCATCAGAATATCGCGTACGCGGTCACTAATATTGTGCTGTGACGTCTCTAGACCACACGAGGCG
ACAAAGAGTGCTGAGGCGACGGATTGAATCTTCAGCTGCGTGTCGGACTCGAAGCCGTCCAACGAAAGCAGACGAGCTGACATTGGTGGGTCACGACTAC
TCAGGACTCGGGCAACTTTGTGGTCTTCTGACGGGGTGTTGAAGACATATGCTTTGTTTGTCGCCATCATAGTCCACGCTCCTCTGTCGAAGATCCACTG
AACACACATTCCTGCACCGTTGGCACGCTGAGCGCCCCCGCGTCTGAAAGAATGCGATGTCAAGCGCTCCGTCACTCCTGCCTTCTTGGCAACTCTCTCC
AACACACGATTGTCGTAGCTGTGGTCTCCAGATGCTGCTTCGGTCACTTTGATCTCGCTGCCAGTGTTTTGCAAGGCTTCAGCTTCTGCGACGTCTTCGG
GGTGGTTGATGGACCAATCAGCGGGGTGGACGGTGTCAACGATGCATGTGCATGGGCTTGCTGTTCTGAAGGCTGGTGCAATAGTGATGCAGAGGGAGAA
GCCTGTGTAATCAGTGCCAATGCAATAGCAAGAAGCGGACACGAGCCAAAGTCGTCGTCTGGGCACCGCGAAAGACCCTGTTCCTCAGACGTCTTGACAC
GAATGAATCGGACAAAGAAAATATCCTCTTAGCCAACAGACATGTTTGTCTTGTGAGGAAGTGTGAGATCTGACGCTCGTCCAAACAGTTACCAGAGTAG
ACAGAGCAGAGCAGCATCTTGGTAGTCCGCAGAAGTAACAGCCGTCGAATACAGATAAACGAGCATCTTCTTCAGCGCCTGCTTGGCACACACCGGTGCT
TTGTTGACGAAAACCCCTGACGCTCTCTTCATGCAATTGCGCTCCATAATTTGTCCTTTTCTAAGTAGGGTCTTCTTAAGTGCTGCTCGATGCAGGGGGG
GGAGCTTTTCCGAGAGCCAATTCTTGGCATGACGATAATACTGCATCACTGAATGACGTACCAAGAGCTGACTTTTGCGCTCTTCCTTAAAGGCTAGATG
CATGCCAAACTTGTGACCACCGTTGCTAGGATTAGCGCCGCATTCTCGCGCTGCATGCTCGCTTCCCAAATACCCCACATAACGCCTTTATCTTCTACAA
ACCTTTTGAACGACCGTGCTGCAGACCCACGAGCTCTCTTTGTGCTGGTAGGTGCGAGGTCCTTCAGCTCATTTTTGACTGCCGGAGTGTCGGAGCTTGC
AGGTTAGGCGTTCAATATGCGAATGACGTGCAATCAGTAGGGGGATATCAATATCTTTGGTGGCCCCTCCGACTTGATTCGTCGAAGGCGAGGTTCTCTT
GCCATCACGTACCCACACCGTTAATGATTGGCTTATAATCGGACGGGTACGTGATTTATTTCGTCGAAACGACATTTTAGCTCGTACCCGTATCTCTACT
TCTATTGGATAATAAAATAAATAGTAAACACAAGTCTGGTCGGAGATTCAATGATATTTATCCGTA