Description :
From Genome Similarity Track
Location :
Scaffold_8:69981- 71020
Transcript NameFunction/comments
Physo_159345PsAvh428

Sequence
1039 bases(100 bases per row)
CCACGATAAAGAAGAGCGGGGCTTGCTGGTTACCAGCCTCACAAACGTTTGGCTGAAACATCATTTCCGTATAGATACACTTCGATGTGCGCAACTATTT
GTTCAAGTACGCATTCTCGGGCAGATGCTGCGGCTATGAAGCAGGCGCAGTAGATGCCCACGTTAGAATCAACTAGAGAGTTGGACTGGTAGTGCTTTTA
AGGATTAAAAACAAAACAACTTTGGGCTTTACTCAATTATTATCCGTTATCATCGTCCATGAAACTATTCGTCGACCTGCGTACCCTCCCGGAGCAACGC
TCCGGGTTGCATATAATCGATCTTGTGATTCGAAACGTTTGTCAAACACCCTCTTTTCGTTAGCTCGATAGTAATATTACGTCGTTATTGTAGCAATAGT
AGGTCGAGAAAATATTACTGCAATACTATATGAGTCTAGCTTTAAATACAACAATAGTTAGTATAGTACAGCATGGGTAATATATGAAATATCCATACTT
TAGTAGTTGTTTTACTAATTTTCCGTACTGTATTTTGCTTTTTCAAATAGCTTCCTTAGGGGCTGGTCGCGCTGGCTGGTGCTGGTTCTCGATCGGGTGT
TCCAGAGATGGGCAGGGGTAGGTGAACTACTAAGTCGGCCTCGAGTTTTCACTTCTGTATTATTTTTGCTCATTTTGGACATAACCATTGCAATTCACAG
AGAACCCGGGGGATCCGCTAAGGAGATAGGGCCCTCGTAATTGAGTCGACATTTGGAAAACAGCCGGCTGTGACAAACGCACATTTGGGTGATTCGTAAT
AGGTGCATGTACCGAAATCGTCGGCAACGCTCTGTGGAAATGATACTGTTGCCGACGACCATAGCTCTACTATAAATAAGCATCCGAGGCAAAGTTTACT
TTAGACTACCGGCAAATAATAAGAGGGATTGAGTGCTTGCCATTTTACACATCTCGTTGTGCTGATGGTGCGCCTTGCTTTCCCACCGTCTGGCTACGCC
GTGTTCTACCTGGAAGTTTCCCAAGCGACGATTGATGAG