Description :
From Genome Similarity Track
Location :
contig_2:699729- 701153
Transcript NameFunction/comments
g602.t1Nucleolar protein 56

Sequence
1424 bases(100 bases per row)
TGTGCTTTTTAGACTTCTTGGACTTTTTCGTGGGGGCCTCCTCCTCGACCTCCTCCATCTTGACGTCCTCGTCCGCAGCAGGGCGCTTCTTGCCCTTCTT
CTCCTTCTTAGACTTTTTGTCAGTCTGAGTAGCCTCCTTCTTAAGCTCCTCCGAGACCTCCAACATCACGTCAGCGTTCTTACGCGGGGCAGCGCCGCTC
TCATAGAAAGCGAGACGCTCCTCAACCTGCTCACGCATCTTGTCGCCGTACTTGGTGGTGGGCTCGTCAATGAAAGAGTCAATGCGCGAGGCAATGGCGC
ACTTGTTGGCTAGGTAACGCGAGATGCGTCCCTTGTTCTTGGCAGCGGCGCGGCCAATGAAGGTAGAGTGGAAGAGCAGACCGTACTTGGGGGTGTTGCC
GCGGGTCTTGAGAGCACGGAACAGAGCCTTCTCGGCACCAAGAATCTGCACCGTCGAGGCCGGGCACTTGGCCAGGTTGGTCAGCGAACCAGCGTGCGAG
ATAAGGCGGGCACCCACCGACTCGCCGATAAGCGAGGCAAGGTTGGGGGCCACCGTCGACATCTTGGACACCAGGTACTCGTGCAGCTGGCGACGGTACT
CGGCAAGCTTAACAAGACGCGTGGTGAAGTTGTCCACGTTGATCATGTCGATCTCCGACATGTCCATACCCATGGAGGAACGCGAGGCGTGCAGGATCTG
CTGGGCCTTGTCCTCGTCGAGGACGATCTTCGACAGCTCCTCGAGCGAGTCCTCGCTCAGCGTGTTGCGGTTCTTGATGAACGACGCGCAACGGGCGTAC
ACGTAGTTGTCATTGACGATCTTTACCAGCTCGGGGAAGTGCCACGAGTACCACTCACGTACGCGCATGGCGAACGTGTTGATGTCCTTGTCCATCTGGT
CCAGCAGCGCAATCGCCTGGATGATCATGTTGTCGGCACGGTTCACGTTGAATTTGACCTTGGCACGCGAGTACGAGTGGCCGAGACCGAGCTGGGCCTT
GGCGAGGTTGCCCTGGGCCAGCTCCTTGACAAACGTGCTGAAGTGCATGCGCACGCCGCGCACGATCTCGAGCGTCGTCTCACTCGTGTTGCAGGGTGCG
CTGAGCTCGTCCGAGATGGCCTGGGCGAGACCCTTGTCCTGCACGCCGAGAGCGAACTTGCCCTTCTTGCCGGCCTTGACCTTGGGCAGGTTCATCTCCA
GGAAGTTCTTGAGGTCCTCGCTCAGCAGACCTTCCGAGATGTTGTTGATGTTCTCGAGGGCGTTCTCGGCCGATGTGAACGGCTGGAAAGCCTTGAGCTT
CACGACGCGTCCGAAGGAGGACATCGGCGACGGCGGCCTGCACCTCGCTCAGGAGGGAGCCGATCTCCTCGTTCTCCACCACCTCAAAGATTGCATAGCC
CGAGGCCGACTCGAATAGCACGAA