Description :
From Genome Similarity Track
Location :
Scaffold_153:6996- 9390
Sequence
2394 bases(100 bases per row)
GCGTGCCCAAAGCTGTGTACAATATGAAGACAAATACAGAGAATATGAAACCGATACCATTGCTGTTACAGACAACTAAGTGATATCACAGGATTTCACC
GGTACTGTGAATGACCAGAAATTTCCAAGAACAGCATGCTGGACGTGGAGAGTTTAAAAGTTAATGACATTCATACATAATACATTTAATTAGGTCCAAG
TGTTGATTCACTCTAGCATATATTATATAGCATTTTGCACGTTGCACATATATACTGACGTAATGTAGCGTTGATTCGAGCGCGAAGCAAAAGTCCACAC
TGTCTCGGTGAATATTCGTGTGATCGTAACCAAGTTTTATCTGTTTTAGAAAGTCAGACGTATAATCATATTGCGTGTAAATTGTGATTATAATAGGTTA
ATTCCTTCATCGAAGCACAATGTCAATATATGTGTACCACGTTCACTAGCGTATACTAGGACGTGGTCCATTTTTCATTTTATCATTATCTGGGGCCTTT
TTATTTTCGTGATAGAATGGGGCATTTTATTATTTGCCCCTACATCTATTGATCATGTTAAGGTTCCATATAGTTATTCTAAAGCACGACATTCAATAAA
TATGATAGGAATCACTCGACCACCTCGACCTTCTTGTTCCGTCACCTGCAGTTCTACCCAAATATACAACAATTACCCAATAATGTACCCAATCATGAAT
CACTCGTTTGCTGCTCCCCAAACACATATGTATTTGCCGAAATCAGTTTTTACATTTTCATCCTTTCTGTCGTTTCCTTCTATTTTTCGTAAGCTTAAGT
CAGGATTGCGTGGCAGAGTTCTCAATCGGCTCTTACTGCACCCACACATAGGGTAAGAACCTTGGGCGTGGATGCGTAGAGCCCGTCGACGCACGCCCAT
TCATTATTTAGATTTAGAGCATCTGCCCACGCCCACCTGAATTCTTTTGCCCACTTTACTTCCAGATTTATACAGTACAAATAAGCCTTTTACACCGTAA
TAAATAAAGCTATATCAAATTAAGGTGCTAAATAATATAAGATTGAGACGACGTGCCCACTTACGTCCACCCACTAATTGTTGGTCACACCCATGACCAT
AAAAATTCATGGGCGTGGGTGGACTTGGGCGTGGACGTGGGTGTGGGAGCCCAATCTAGGACTTTGCCGTATATATTTTTCTTTCGTTTCTACATTTCAT
TTCCTTTGTGCTTGCTATATTTTTAGCCATAATTCGTCTGACCCCTTGCGGCGTGGAGAATCATGTTCTCGCTTTGTGTCCAACGCAACGACAAATGCGA
CAACTCCGGGCAATAAGAATTGGCTCAGCCGCCAGCTCCACCTGTCCAAACTCTAAAAGTAATCGCTGCGCTAAAAGCATCTGTCTCTATTGGGTTTATT
CGATTGCCCTAGTTGCTGAAAGCGTTACTCAACGGGCTTTTCTTCAAAACATCTGGTAGCAAACGATCCAATACCGTCATCGACTCTATTCAGGAGTCAT
CAAGAAGACAGGGCTACATATCCTCACGCGTTTTACAGAGATATTAATGGAGCATTAAATATTCCATCCGATAATCAATAAAGACTTCTGCTCACCGTAG
CAACGAGAAACTTCTGGTCAAGAACATGGAGGAAGTGTCTAGTTTTTTATTAACCCTATGCCTTTTAGTTGACCGCGTTTGTGTAGCTTCATTCTCACGA
AGGGCAACATATTCAACCATGTTGACAACCTTGCGCTCCTTCATAGTTTGATTGATATACAAGTGTACATGCTACTTTTACTACAACATTGCTTGATTTC
CTCCATATGTCTCCGTGTCCACCTGCTCACGCTCATTTAATGGCTTCTTCATAGGAAATCCATGTTTTATTCCTAAACGTAAGCGATGAAACGAAACGAT
TAAGCGATGATTAAAGTAAAACCTGCTTTCGGCAAATACATATGTGTTTTAGGGAGCATCAAACGAGTGCTTTCTAATTTGGTAGAATTTTGAATAATTG
TTGTATTTGGGTAAAACTGCAGGCGACGGAACAAGAAGGTTGCGGCGACCGAGTGATTCCCGATCTCATTTTTTGAAAAATGTATATGTATATATACATA
CATGCGTATTTCAGTTTCAAATTAGATATATATATATTGAAAGTCAATATATTGTTTATGGAAATCCTTATAGTTCAAGCTAATAATTGCTACTCTTCCC
CATTTTGTTTGGATTAACTCGCCGTTTGAGTCACATTTTTGATATAGCATGTCTGCATAGACGAACGTACGCACAGCGTTTCAATCTCCTACTGAAGCTT
TGTATACAAAGTTTTAAAAACTATACAACTGCAATTCCCGTGAAAATAATATGGTCCTCGTTGGGTCGCTTTTCAGATGTTATTGGTTTTTATG