Description :
From Genome Similarity Track
Location :
Scaffold_17:69944- 72244
Transcript NameFunction/comments
g4618.t1hypothetical protein

Sequence
2300 bases(100 bases per row)
CCATTGAGATAGAACGCGGTGAACCCCGTCGACGTGTGCATCACGTTGTAGAGTGCAAACTCAACCATCGGCAAACTGGCCGACCTTGTGTGGGGAGATT
CCGCACAGACACTGCGCAGAGTGTCTTCGAGCACGCGATTGACGCGCTCTGTCTGGCCGTCCGTCTGCGGGTGGTCGGCCGTGGACAGGAGCAGCCGCGT
TCCAAGCAGTTGGGACAGCGTTTTCCAAAACGCAGACGTGAACCTTGGGTCACAGTCAGACACAATAATCTCCGGGAGGGCATGATAGCGGAAGATGCCA
TCGAGGAACAGCCTTGTGGTCTGTTCCCCGGTGACTGAGTCAGCCACCGGAGCAAGATAGTACATCTTGCACAAACGACAGACAAACACCAGGACGCCGG
TATTGCCCTGGGCATCAGCCGGCAGTCCAAAGACGAAGTCGAGACTCATTGACTTCCAGTAGTCTGCAGAGACTGGCAGACTCTGTAAAGGAGCCAAGGC
ATGACCAGCAGGTTTCACACATTGGAATGTCTCACAGGTCTTCACATACGTGGCGACCCACTTATACATGTGGGCCCACCAGGATACCTGGGAGACCGGC
AAGAAGATCTTCTCGCGGCCAAGGTGGCCGCTGGAAGGCGCATCGTACGCCTCCTGAAGTATGTCATACTTCAAATTCTCGTCATTGGGGATGACTATCT
GCGGAGGATCGGCCGGGTCCACGCGATAGTGGAGAAGGCCATCGACCCACGCATAGAGATGGAGTCAGGAGCGTTGTCGAGGAGTTAGTATCGCAGGCTT
GGCCTTCTTGCCAGCGGTAAAGAACCGCGCGATGGGTGAGAGATTATCATCATCTCGATACGCAAGGCGTATCCGATCGTACAGATTTGTCGTGACCCGA
CTAATGTGCGGAAGATCATAGTCGGGTTGCCGTGGCAGCGCGTCAGCAAGCAGGTTCAGCTTGCCCGGCTTGTATTCCACGCGGAAGTTGTAGTCCGCCA
AGAATAACAGCCAGCGGGTCATCCTCTGAGACAGATGCGGAGAGCTGGTGGTTGTCCTCAAGGACGCGTGGTCTATTAAGATCACGAAGGGTTCAGTGTA
CCCGGAACTTAACAAGGGCGTACTTTATAGCGGGGAGCTCCTTATGATGAACAGGGTAGTTCCTCTCGGCGGCCTTTAGCTGCCTGGACTGAAACGAGAT
GACTCGTTCGTGCCCGTCCGCGTCGTACAACAGCAGCGCGCAACCAATGGCATAGTCTGAGGCGTCACAGACAGCGCTGATATACATTGTCTCGTCCGGT
AAGGCCAAGCCCGGCGCGCACTGCAAGTTCGTCTTGATGCTTGACCGCATTCTGATGATGGCTTTCCCAGGGCCACTCGACATCCATCTTGCGGAGACCC
GACAGGGGTCGTGCCAGCCTGACATACCCCGCTCTATACTTGTGCAGCTTGTTGGCTAGGCCTAACCACTTACGGAGATCCTTTTGCGTCTTGCCATCTT
CGGCATGGCTATGGATGAAGATATCGTCAAAGTACGTCTGCGTGAACACACGCAAGGGTCTGAACAATTGTGTGACCAAGCGATTGAAAGTCGCTGGGCC
ATTTGATAGACCCCGTGTCATCACTAACTATTTCCAGAGCATGTCGCTCGGGATGCTCACCGCTGTGAACGGGATGTCGCGCTCGAGCATCAGGATCCGG
TAGTACCCATCCACCAGATCCAGCGCACTATAAAGCTCGCAGTCCGCCATGTTGTTCAACAACACTTCCTTGCGAGGGATGAGTGTCTGAGCGGGCTGCT
CAGCTTGTTATAAGCATGAACCAGACGTCACTTCCCGTTCGGCTTGCGAAGGCAGAAGGTGGGCGTCGAGTGCGGAGACTTCGACTCACGCACTATGCCT
GCCTTTGCTTTCGCGCGAAGAAGACATCAACGACCTTGCACTGTTCGCGAGGCAGTGACCATTGTCTGGTCACACCACACATTACTTTGTGCCTAAATCC
ACGGTCAGGTGGGAGTTGGGACGGCGGATCCTTGGACCCTACGTCCGATAAACCCTTCATCAACGGATACACTAAATTATTGGGGCTCTTGAGGATTGCA
GAGCCCACGCGTGTCGCGCACTTCTTGCGGAGTTCGTCCAGGACGTTCTCGTTCATAACCGAAGAGGAGTTCAACTCTTCTGGAGAGACCTCCGGCTTCA
GGAGCACCATCTCCGCGATTGCCCCGGCCTTCAATTGTGCCAGGAAATCGTCCATCGACATCTCTTTGATGTTCAAAAGCTCCGACACCTCAGGCAGGTC