Description :
From Genome Similarity Track
Location :
Scaffold_138:6994- 8047
Transcript NameFunction/comments
Phyta_totarag4357hypothetical protein

Sequence
1053 bases(100 bases per row)
GAGGCAGTAGGAGACGCATACGACGTTCTCCTCgtcgaggaagctgcaggtgaagCGTACGTTGACGGTCTTGTTAACACATGGTGGTTCTGCTTTGCTG
CGCTTTTGCTttttgctgaagcaggaGACGATATTCTGTTTGACTTCGTCGGATTCTCTTGCTGCTTTGCTGTATCACGGACATCTTCTTGAGTCGGTTC
TCCAACGGTCTGAATTGCGTCGGGGGTACTAAGTGCGTTTTCCACTACGAGTTGTGCTGGTTCATTCATCTCCACATCTTGTTCCCAGTCTGCTGGTTGT
TCGTTGTTGTCGCCGTATTCATTTCCCGTCCCAAACTCAAAGTCAGGTTCTGAAGCCCACGGCGGCCTCTCAGTCAAGATTTCATGCGGAGGTGATCCAT
GGACAGATTTATCGCCATTGTCAACATCACGTGATGTATCTGCGCTCGTTGTTTCCTTCTCAACCACAGCCTCGGCATCGactttctccttctcttcttc
ttcttctccttctttctcgccttcctcgcccTCGCTATCACTGCTGAAGACCAATTCCTTGGATACATTcatatcttcatcatcgtgATGCCCCACCATC
AGATATTCAACACCTTGCTCATCTGCAGCTATATCTTCACACTCATCGCTCTGCACTtgttcatctccatctctATGATCTCCTTCCTTCGTCACCGCAG
CTttttcctcttcatcgtgcACTTCAGACACATCAATCATCTGCATATCTTCCGCCTCCGGCTCATCGTCATCCATGCAGGTCTGTTCATCGCCACTAAG
ATGCATAGATTGCATGGATACATCCAAGTCATCTCCTCTAAAACTTGGTTCAAGGGATCGACGAGGTGTTCGTCGCGTCTTTCCGGCCGGTTTCGGCGAC
CACTGTCCCGGTGTCCAAGGCGACTTTGCCGCTCCCGAAGACGGCGAAATCGTCCCTGCACACTCGACAGAAGTGCGTCTATTGTCCGCAATCGGCGATA
CGTCAGCCATTCGCAGTTGCAATCGCTGTGAAGCGCTCACTCGGCGTTGAGGC