Description :
From Genome Similarity Track
Location :
Scaffold_351:6993- 9517
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_351-fgenesh-gene-0.1PH domain containing protein
Pytve_DAOMBR484maker-pve_contig_351-snap-gene-0.22Transmembrane protein
Pytve_DAOMBR484maker-pve_contig_351-snap-gene-0.15Gene of unknown function

Sequence
2524 bases(100 bases per row)
CAAGACATCTAATGGCGACGTCAAGACGCCAGAGTCGCTAGTGGAGTCGCACGATGCGTGGATGAAGCTGCAGGTGGCGGATCGGATGCAATGGCGGCAC
GGGTTTCGCTCCAACAAGAAGGGCGGACTCGTCTTCTTGGACGCCGACGCGCTCAAGAAGCAGCAGGGCGTGGTCAAGGAGATCATGCTGCAGGTCGGCG
CGCAGCTGCTCAGTGGCAAGCTGGCCGTGCGCATCTCGCTGCCGATTCGCATCTTCGAGCCGCGCACGCTGCTCGAGCGCGTGGCCGACGGCTGGAACTA
CGCGCCGACACTGCTGACCAAGGCTTCGCGACCTGGCACCGACCCGGTCGAGCGACTCAAGCTCCTGATGGCGTTCGTGGTCGGCGGCTTGCACTTCTGC
GCTGGCCAGCACAAGCCGTTCAACCCGATCGTGGGCGAGACGTACGAGGCGACGTACGCGGACGGTGCGCGCATGGCGTTCGAACACGTGAGCCACCACC
CGGTCAAGTCGGCCTTCAGTCTCACTGGGCCGCAAGAGCGGTACCAGCTCTCGGGTGCGTTCGAGTTTGAGGCCGTCTCGAACGGTAACGCCATCACCAA
CCACCAGATCGGCACGGTCAAGATCGCCTTCCGAGACGGACAGGTCGTGACGTACACGATGCCGCAGATCAAGGTGAGCGTGTTTGCATTGAATGTCTGA
CTTGAGAGGCATCCTCGCTCACCTCAACGTTCTTTGACAGATGCACGGGATGATGTTTGGCGAGCGCGTGGTCGAGATTGTGGGCTCGGCAGTGTTCGAG
GACCGTACCAACAACCTTCGCGGCGAGCTGCAGTTCGACGCCAACAACGGCCTGTTCAAGAAGTCGCACGGCGACGACATCAAGGGCCAGATCGTCGACA
CCAAGGCTGGGCACAAGCACGCGATCGCCAAGGCTCATGGCTCGTGGCTCACACACCTCCACTTCAACGAGAAGCCGTACTGGGACGTCGAGACCGAGCC
CATGTTCGAGCACACGCCGGTGGCCGACGCGCTGCCGTCAGACGTGCGCTTCCGCGAAGACGTCATCGCGCTTAAGGTAGGCAGCCTGGTGTCCTCGTCG
TGCCAGTGCAGACAAAGCGACTGACTTGTTGCGTGCTGCAGAACGGAGATCTGGTGCTCGCACAGTCCGAGAAGCTGCGGTTAGAGGAGCAACAGCGCGC
GGACGGACGGCTGCGTGATGCCACCAAGCCACAGCCACACCGCAAGCACTAGCCACGGCCCAAGACGACAGGGTCAATCGCTCTCTATATTGGTCAGGCC
ATTAGGCGTGCTAAAGGCAACATGAACATGCAACCACCCTTGCTCTCGTCGGCACACGGCCACCGGAGACGGGGGATCATTCCTTCTTGGCGAGCTTGCG
GACCTTCTTCTCGTCCTCCTCGGCCGCGTGCTGCTGCGCAAACTGCTCGATGCACGAGATGGCAAAGTAGGCGATGAAGGCGACCATGACGAACGAGCCG
AGCTGTGAGAACAAGCTGGCGTTTGCCTCTTCGCCCGATTCGTGCTCGGCCGTGGCCTTGAGGTGGGCCGAGTGGAACTTGTTGCGGCACTCGAGCAGGA
ACTCGCTGACACGCGCGTCGAGTCCCCACTCGGAGGGCGTGACGCGGCCGATGAAGTGCTCGACGCGCTTGAGGAAGGCGTCCGTGAAGATGGTGATGAA
GAACGCGGCCTGCATGTTCACCTTGATGAGCGCCTTGCCGATGAGCGTGGCGCCGAAGAAGGTCCAGAAGGGCATGAGGAAGTGACCGCAGCAGATGCCG
CACAGGTCGAACGCCACGTTCGGCCACGCCGACATGAGCAGCACGCCGAAGAAGCCGTGCTTCTCGAGGAACGTGATCATCCACTCCTTCATCCAGTTCA
GCACGTTGTAGCTCGACTTGGACTCGCTGATCTCCTCGAACTCCTCGTTGCGCTGGCCCGCGAGCCGCGCCGCGCGACTCAGCGCGTACGGAGGGATCTC
GCCCGCGGCAGTGCCGGCTCCCCAGAGCATGCACGGCCAGAAGACCTTCCAGAAGATGGCCCAGAACGTCACGGTCGAGACCTCGGGGACATCCTGGCAG
TTGGCCTCGAACGACCGGAACCACATGTGGTGGCGCGAGTCGAACGCCAGCGACTTGCACTCCTGCGCGCCTTGCACCACGAGGAAGATGTGCGGGAAGA
GGAACAGGATGCCCGAGTGCATGCCCGTGCCGAGCCCGACGGACGAGAGCACGCCGAGCCCGACCCACCACACGACGAACTGCACGAGCGCGTTGAACTC
GTCGAGGATGGCGTGGTGCTCGCCCTCGACCAGCGTGGCGCCAACCCAGAGCGCCAGCAGCGGCAGCAGCGCGAACCGCGTCACGTTGTGCGTGGCCACG
CGCACGGCCAGCCAGCGCAGGAACCGCCCCAGCATGATGGTGAAGTGGTACAGCACGCTCAGCGGCCGCCGCAGCAGCGTCAGCCGCTTGCGCTCGGCGC
GAAGCTGCTCGGCGAGCTGCGAGC