Description :
From Genome Similarity Track
Location :
contig_2:69927- 71737
Transcript NameFunction/comments
g496.t1RAW25623.1 hypothetical protein PC110_g17960 [Phytophthora cactorum

Sequence
1810 bases(100 bases per row)
CCACCCAATCACCTGACGAATGCTTCGGACAGAGAGGACCGACAGCCGAGCCCTGGTATCCAGACACTTCGCGTTTTACCTGCCTCACCTCAAGTTGGAA
TGAAGTTCCCGTTGTCAGCGTGCCCGTTTCAGTCCTTGGAGCTCATTGAGAGCGAGAAGGACACCATCAAGTCGATCTCCGATGAAATCCTGACCGAAAC
CATGGCGGAGTACGAGCGGATGCTCGTTCATGGCCACGGCGTCCTGGATACGGAACGCTGGAAACTGATCAAGCGCAAGGAAAACCTCGCAGCCTACCAG
GATCGATGCGCCCTCGCTGTTACCCTCCAAACATCTAGCAGCACCACCAAACCGACGGTCGAAATCGCCGACGACCCGGTCGCGCCTCCCCCAGCACCGA
TGTCTGGTGCGCCAGGCAAGACCCCGCTACAGAGAGTGCTGTGGCACGGCACGATCAACTGCGACCTCGACGACCTCATGCTTGGCGTCGTCAATCAGAA
CGCCGACATGTGGAAGGTCAAGTCCTCCTACGTCGAGGACAATGGCCTGGATTACTTCCTGCTCGCATCGATCAACGAACGATCAGTTGAGAAACCGTTC
GACGGCCTCCAAGTGAAATGGACTGTCAACGATATGGGTCCAGTGGTAGCAAAGCCTATCATGCGCCCTCGCGATTTCGTGTATATGGAGAGCACAGGCA
TCACTCTGTCCCCCACAACCGGCGAGCGAATGGGCTACCACATTTGCCACTCTCTTGAACTCCCTGGCGTTCCTGAGCTGCCCGAGTTCAAGTTGGTGCG
GGGCAAACTGGAGCTGTACCACATCTTCCGTCAAAAGAGCAAGGGCGTCGTGGAAGTTTACGTTCGAGCGCTTTGCGATCTGCAGGGCGAGATGCCGTCC
ACCAGCGTGAGTCTGTTTTCGGCCGAGGCGATGTCGTCGCTTGCCCTCGCGGCATTTTGTGCAGAGCGTCACAAGGTCATGTGGTTGTTGCACACGATGG
AGCCGTGCGAGAGTGGCAAACCATCTCTCGACCTCTGCAGTGTGTGTACGAAGGATCTGAGCAAGAGTCTGCTGCCGTTCATGAACAAGGCCTGCCGAAT
TTGCTCGGGTCGCATTTGTGCTCGCTGCCGGATCCCAAAGCGGCTGAGCTTCCTCAATCGGCGCACGCGCGGCGTCATGAAGAAGAACATCGACATCTGC
ACTCGCTGCGTGCACACGTCCGCACACATGAGCGCTGTTACAGTTGCGCAGGGTGAGTTGGCGCTCGAGAACCCGACATCAATCTTCTATGAATCTGCGG
TCAACCGAAGCGTGTCCTCCATCTCCTCAGTGTCTTCTGGCTAATACTCCTGACTCTCCATTGAAGAACCATTCGCGAGCAGGTCGAAGTGTGGGCAACA
TCGATAAATATGCTCTCGCGGAACGAGGTCGTGCAATGTAAATTCGTATGTGCACAATGCATCTATCAAATATCCGTTTGCTTCACTGCTTATACCTTCG
TTGCGTTGGAAACGGGGTTCGCCACTGGAAGCCGTGCCTAATTTGCCCTGCTGTTCACTTCATAATAGTGGCGAATCGTTTCCACCTTCTCAAGTTCACC
CAGTCGACACGCTGTATTCTGGTTGTAGCTCCAGAACAGATGAAAGCCGCCACATATCTCGAAACAGCCTTCGCTCATCTACTACAGACATCTAGGTGCG
CCGCAGTTCAAGTCTCGGTTGCTCTCCTCTACCACTCGGAGACAATCTCGGTGGAAGACAGACGGTGGAGGAGGGAGGCGATTATTAGGAGGCGCTCCAC
AAAATGGAGA