Description :
From Genome Similarity Track
Location :
Scaffold_32:69919- 71339
Transcript NameFunction/comments
Phyca_LT1534117080HCP-like protein

Sequence
1420 bases(100 bases per row)
cgcctggaagctgctttgaacgcgcaacttcaactttaacgccgccatgacaatacgtagcgctggttctttctcgcctgcaaggtggtagtacagtgat
gatcgctctgaggaagcaaaagccattccgtagccatgctcgtacatgtatccaacactgtacagcgcctgagcacaagttccagcacttacgaggtctg
cgtgttgataatgtcgcagtgcaaggacatagttttcctcgttgaacgcgttatcacccatacgtaatagaccgtcaatgctatcttgaccaacagctcg
agtaattaaccgcgaatgcaaccgagtcagtagtttcgagtctcggtttgccgaagcgccaaatagttgacgctggatacgttcaatcaaccagatcgca
ttgctttgcgccacttcgtagcccatttcagccgcaatcaagtatagttctagagccaccgcccaattaccgcgttgagcgtgtgtcaaagctttcgtta
tcacttctgtaccctctcgagagtattccgctacacgtttgcagagttccaccacttcttcacaggaaattctgctggaactcgaatgaagttgcctctg
tttgatccgagctagctggaaaagagatttaagatggccaacgtgagccgctgcaacgaaatattccttcgcccgtgctgtgtgatacgttcccagttcg
aggaaagccatgccagtattgtacaccccttcagcgtgaccagcactagctgctatcatgaagagcttacgcgctttttccagatctacagggacatctc
caagtccacgcgaataaattaccccgagaccattagcagcttcaccactttgtgacgcattgagtgctgattcatacaattccacggcttttgtgacgtt
agaaagacatccagcaagaccatacgcgtgcacgtgacccaggagagcttgagcctggatactgcccaagtcaattgccttctccaagaattgaacggct
tgtcgttcacgtgctgcatgttcttcaacatcagatcgatctgaagtcttgtagagatcactgaacagagtaatactcgcagactggaccattagctcag
cactgcggaagtctttggcacgttggcgaagatattcagctcgttggaaatcttctgctggattgacatcaacttgatatcgagtaccttcagtctttgc
aagtcggataggttcggggaacgcgtacagctgaaacttttggtcgctgtgagcggtgacaactcggtctgcagcgtatttgtagtgctgcattgcagtc
gaacacgacttcggcgtaccgaaaccatgcaacgagcgatatcccagtgccattgaagctccaattgaacctccgtgagctgcaaactccaagtacaagc
gtgcagaagcttcgtcatca