Description :
From Genome Similarity Track
Location :
Scaffold_15:69918- 71353
Transcript NameFunction/comments
Albla_Nc14019190conserved hypothetical protein

Sequence
1435 bases(100 bases per row)
TTCCTCGGAGGATTGATTGCAATGGAACCACAATACTTTCCGCCCACATAAGGATTAATTGTCTCTTCGAACTTATACGGTCTCCGCCGAGTACAAATAT
AATGACCACCCAATCCATCGCTCGGAGTCATGTATCCAAATGTGACCGTTCTTCTTGTACCTTCTCGGGAAGATGGAAGACCTGCTACTGGAGTCACAGG
CTCAATTTTGAAGCTCTCGTTATTACTAATAAGCACAATCTCGATATTGAACATGCTGGAAGCTGCATATAATTCGGCGGTCGTAGCCTGTTCATCGGGT
GTATCTCTGAAACTCTCATATCGCATTCTCAGTTCGTCTTCTTTTTGATGCAGAAAACTCGCTAGCTGTTGCAAATGCTCCAAAGCGTACTCCATAAGCT
TGACCCGAAGATACCTGGCTGCTGCAATTCGTCGTGGGGCCATCCCGTCAGCAGCTCCAACATTCACAATTGTCATCGAAGTAGGATAATCTTTCAAACA
TTGCAACGGGTACATTTCATAGACAATACAATGCAAGAGACACGATCCATCTGGAGGCATTCCTACACCCACCATATCGACTTTGTATAATTCCCGTTCC
ATCTTTGCTCTCTGTTGTTCTGATTCATGCGGTGTTTCACCCATAGCTTCCCCGTATACATCCATTCTACCAGAATTTCGATTGGTAGATAGTAGGAGTA
TATTCTTTCGACCAAAAGTTGACTTGGTGCTGGAAGGATGAGAATAACTCGATGCAAAAGAACTCGTTCTTTGATTGGATACACGTTCGGATTGTATACC
ATACCCTTGAAACCCAGTTCCTGACCACCGATACACTGCTGAGTTTCCAAAACTTGAGGAATTTGAGGAATAGGTGGATGAGGCAACCGATCGAAAATCA
TCGTCATCGTCTGCCACTACACTGGCTGAGTGCATGTTTGCCATAAGAGATGAGGATGTTAATTTGGACATTGAGGGATGTACGTTGGAGGGTTCATACT
CAGCATTCATACCAAAGCCACTCACAAATCCAATAAAAGTTTTAAGTGTTTGACTCTGAGGCAAACTTACGTGAAATGCAATCACGGAGGGACTTTGAAG
TACCATACGTAAGTACGTATCGAGTTCCCTCATTCGCATTTCCAAAAAGTCTTCCCTCAAATGCGATCGAATTATCGAACGGCGACGATACAGAGGTGGA
AACTGTATCCCTTTCATATGTGAGGGATTGCGTTTTCGTAAAAGCTCATCTAACTTTCTGAATTTCCCAAAGGAGCGCCAAATGTGCCAGCTGGTCGATC
CAATGCCGCGTGACCGTGAAGAAAAGAATGAAATTTGAACAATGATTTTATACTCTGCTTTCTTACGGATTCTGAACTCTTCAATCTTTAGACTGCATTT
ATAATCGCCTTCAATCTCTTCGGGAGTCATAGTCA