Description :
From Genome Similarity Track
Location :
Scaffold_969:699- 3585
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_969-fgenesh-gene-0.0General transcription factor IIH subunit

Sequence
2886 bases(100 bases per row)
ATGGACGGCGCGGCGGCGACGGCGCAGAGCGCGCTCCTCAAAGGAGCCGACACGATCACCCACCAGGAGGGACTCTTGGTGCTCGTGATCGACACGAATC
CAGAGCACTGGTTCCCCAGCGCGAAGCTCCAGAACGCGCAGAGCCAAAGCTTCCAGCAGCTCATTTCCAGTGCGCTCGTGTTTGTCAACTCGTATCTCTT
GCTGCACCGCAGCAAGCGCATTGTGATCATCGCAGCCCACGCTGGCCGTAGCGAGATGCTTTTCCCCGATCCTGACCAGCTGGATACCTCGGGGCGCGCG
GAGCAGTCGCTGAAAGTCAATAGCCGCGTGATGGAGAAGCTCCAAGCGCTCAGCAAACTGCCCGTGGACCCGGCAAAGTCGAGTGCGACGGCCATTGCGG
CGTCCATTTCCAGAGCGCTGTGCTGTACGTAGTTCTATCGAAAGCTTCCATTCTAAAGGGGATGCTGNNNNNNNNNNTCTGTGCTGTACGTAATCCTATT
GGAAGTTTCCATTCTAAAGGGGATGCTGAATATTGGGCGTTCGCGTTCCCCTTCGTATGTTGTAGTCATCAACCGAGCGATCACCGAGCAGGCCGATCTC
CACCCCCGCATTCTCGTGATCCAGAAGTCGCCGGATGTCTCGGAGCACTACATCTCCATCATGAACGGCATCTTCTCGGCCCAGAAGAAGAGCGTCGCGG
TCGACGCCTGCATCTTGGCTCGCGACCACTCGTCGTTCATGCAGCAGGCCGCGTACCTGACCGGCGGTATCTACTACAAGCCCAACGACGCGGGCGCGTT
GCTGCAGTACCTCGTTTCGATCTACCTGCCCGAGCCCAGCATGCGCAAGCTGCTCAAGCTGCCCACGCAGGACTCGGTGGATTTCCGTGCCATGTGCTTT
TGCCACCAAAAGGTCATCTCCACGGCCTTTGTGTGCCCCGTGTGCCTCTCGCTCTTTTGCGAGTTCAAGCCAATTTGCTCGACGTGCGGCATCCGCAGCC
GCATTCAGCCGACCAAAAAGACCCCGCCGGGCAAGCGCATCAAGCCATCGACGTGAGGCGAACGTCGCGAAAAGAGCAATACACTACATAAACACCTAGA
GGGGACATCTCCCATGACGTCACCATGACGACCCGCGGAACGGTGAAGGCGCCACAAGAACAATCTCAAGCAGTGGGATGACGTCTTTTCAACCAATGAA
ATGCGGTTTTGAAGGGTTTTAGCCAATCAGATCACGAAATCTGATGATGTTGACTGGATTGGTTGATGGATCCGATCCCATTTGATGGGCCAAACACCTC
TCTGCCGCGTGGGCCATCACAACTGAAACGCCACGCCCGCCACGACAGCGACAATATGAGCAGGTACGAGAGCGATTGCCCATGGGTCCCTAGTGTGTAT
AGGTGGCGGAGACTCACTGGTGCTGTGTTCAGACCGACCATTAGCGAGGTGTTCCAGCAGGCCAAGGCGGCCCAGAAGCCAGCGTTCATCACGTTCACGT
GCTGCGGCTTCAAGACCAAGGCCGACACCGTTGAGATCCTTCTCGGCCTTCAGCGCGGCGGCGCCGACATTATTGAGGTGCGCTTAACACACCTCTCTAT
GCGTCTCTGTGGGTCTAATATGGAGATGCTCACTGTTGCAACTGTCCACAGGTCGGCATCCCGTACTCGGACCCGCAGGCCGATGGCCCGACCATCCAGC
GCGCCCACCAGATTGGCGTGGACCAGGGCATCACGCTGCGCGACGTGCTCTCGACCGTGAAAGAGGCGCGTACCAAGGGCCTCACGACGCCCGTCGTGCT
CATGGGCTACTACAACAACTTTCTCCAGTACGGCGAGAGCAAGATCTGCGTTGACGCCCACGAATGTGGGTACTTGCCCTCGTGATATTCATGCGCATGG
ACCGGATACTGACAGTGTATGTGCTTCTTGGAAGCCGGCGTGGATGGCTTCATCATTGTGGACCTGCCGCCAGAGGAGGCCGCGTTCCTGAGCGGCGAGG
CCGCCAAGAATGGACTCGCGTACATTCCGCTCGTGTCGCCCACGACGACCGAAGAGCGCATGGCAAAGATCGGCTCGGTCGCGCACGGCTTCGTGTACTG
CGTGAGCCTCACGGGCGTCACGGGCGCGCGCTCGGAGTTGCCGGCCAACCTCGACGCGTTCATGGCCAAGAGTACGTCCACTGATGCGAATGGGTGATGA
CTGAGGGGGGGGGGAATCTCTCATCGTCGATGGCTTCTCTTGCTTGTTGTCTACAGTCCGCAAGCACATTTCGCACCCGCTCGCGCTTGGCTTTGGGCTC
TCGAGCCGCGAGCACTTTGTGCAGGCCGGTGCGTTTGCCGACGGCGTGGTCATGGGCTCGAGCATCATCAAGGTCATCGAGGCCGCGCCCAATGACACGG
CCGCGCGCGCCGCCGCCGTCGAGGCGTTTTGCAAGACCATTGTCCAGGACGCGTAGAGCCCCTCTCTCCTGTACTGTACGCGTAGCAGTAGATAGCGTTG
ATCCACCATACAAAGATGAGTTGCCGCTGCCAGAGTCCTTCCTTCCATACAATAGCCAAATGCGCCAGACGCATGCAATGGAGTGAATCGCTCATGTTGG
CGTCGGATAGCGCTTGTGTATATTCGTTTTGTATGGGTTATTATTGTGAGGAAACCCAGGAAGCATTTTGTCCGCGTCGTTACGGCACTCGCATCTTGCT
CATGTCCGCGGTCGATGGCACGGGTTCGAGTCCCGCCATGGTCCTGGAATTCCCTGTGTTCATGTGTGGCGTCTGTCCGGATAATTGTCATCCGGATAGA
GGTGGTTAAAACCCCGTTTCGCATTCTTCGAAGCCCAGCGTGTCTTTCCCATTGGACTAAAGGCAGGGTCAAAATGAGTGCAATAG