Description :
From Genome Similarity Track
Location :
Scaffold_819:699- 3084
Transcript NameFunction/comments
Phyke_g11105conserved hypothetical protein

Sequence
2385 bases(100 bases per row)
ACAGCATCGTGCCCGAAAGCGTGTTGTCAGCTCTTGCTGAGCAACATCCAACCCTTTCAGTGGATACCGTCGCGAACGCCGTCATCGAAACTTCCCCTTG
AGTGAAGCTGAGCGGGATGAAGACAAACTGCTCTCTTGCTTCTTATCCGTCGACAACGTCCAGGCGGGGCTTGGGGGCACAGACCTCGGGCCCCGAGTCG
AGGCTTGTATCGGAGCTATAGAGCAGAGTACCTAGTTGTCGACGCATCCCGTTTGACGCGTCTTTGCTGGGCCGATAACCCATCTCCAGAGTGTTTGTTG
AATAACTCTGCTGGTCTGAAGCAGGCGAGTGGATCTCGTCAAAATACCACGATCACGAGGTGACTGAGCTGACTGTACGCTTGCTCCATTCGGACCGTTC
TTCGAGACCAGAGCCTGCCGTGCCGTGCCGAGCAGAGGCAGGCACGTGGAATCGTGCCGTTGGAGCACTGGCAGATTTGTCCTGGGTGGGCCATCTGCAA
CTTTTTCCGGAGCGTACTGACCTCCAGCCAACACTTTCGCGTTGCGTAATTCATTGCAGACATCTCCCTTTTACTGCTTTCTGCCCCTGAATTTGCCATC
ACTTTAGCGTTGATACATTTTCCCGTTGTAACATTACTACAAACTTGTACTTGGTGAAAATGAGACAAAGGGTCAGAAATTATACTTGTGATTTGTATGT
TGTCTCAATTCAATCTTCACTCCGCCAATCAAATAGCGGAGACTTTCGTCTACTTCAAAGAGAGGTGTCACATGTCGCCGAACGAGGGCGACTATCAATG
AAAACATGCCAAAAGTTACAAAAGAGTACACACTTTGCTCTCTGCAGACCTTATTTCCTGCACTATCCGGTTCACGGCCTGCCCATGCGCATCTGACGCT
GATGCGATGACCTCTTCACGTCGTCAAGCAAGCAAGCACCGACCAACAGCCCCAGATTGccatcagcaccacgttTTGTGCTTCCAGAGACCTTTTCTGC
ATTGTTAGATCACTCGGGGAGGCAAAAGAACTCGCCCTGTTTGAAACATGAGCAACGATCACTTGTCGTCGCGGCGCTCCAACAGCTCAGATAGTGCGTC
CACCGTTGCGGGGCCTGTGAGCGTGGCCGGCACCACCAATGGCTACGGTTTCCGAAGCGCTGGCGGAGATGCTCTGTCCATCGAGATGCAATTCCTGAAT
CCGCGGAGACGCTTCCCGCTTGCAGACGAGTACTTGCCTCTTGTGTACGTCACACACGAACAAGTGGAAGATTTGCGGGAGACGTGTGAACAGCTCATGG
CTGATGCACTTGAGCTCGCCGGAATGTTTGCGTGGGAGGACAGCAATAATAACGAACTTGTGGGGGAACACCGCGATCAATGGAAGGTGCACTACCAACG
CCCGCATGTCACGCTGTACCGCAAGAAACGGGGGAAGGATGCGATCGCTGATGAGCTCGAGGATGCCACGGATGATAGCAACGGCGGCCTGAGGCACTTC
GTAGTAAGTGGGCAAATTCACGACATGTCGCTTGAGGACGTTGAGTATGGACTCTATTGTGATGCCACGCTGGACGAGCGCGCCGTTATGACAGACTTGT
ACCGCGAACTCTTCCTGGATGCTGCCGTGTTGCGCAGCTTCGAGACGCAGACGCCGGAGGACCCGTTTCACTTCTTCGGTATCAAATGGCTCGCTCACCT
CAGCCCGGCGGACAAGTTTATCTCCCCGCGCGATTTCGCTTTCGTTGAGTATTCCCAGCGTGCAGTGGGTCCTAAAGGAGAGCCGCTACTCGTCAAGGTG
CAGCACTCGCTGAGTTCAAAGCATGTGGACGCCATGAATCGCCGCGAGTTTGATCTTGTACGAGCACAAATGAGCTGCACCACAGTATACCGCCACGACA
AGCGTGCCAACAACGTACAGGTCATCGCCCGTGGTCACTTGGATCCATGTGGTAATGCGCCGACAATCATGACGCGTGCATTTTTGACACGTTTGGCGCC
TACCCTCGTGGAAGTCGCGCACAGCGCTGACGTCAAATACATTATGCGCCACGGACTTGTGCTTCCCAAAGAAGCGTTCTTTGCGCGACGTAATGCGCTC
AAGGCTCACGGTCGCCACCGTCTGCAGTGTACGGCATGCGGTAAACGTTTCGGGCGACTCAAGCGTCACTTGACACAGTGTCGCTCCTgcggagaagcag
cttgCGGCCATTGCCTCATGACGTACACGCTGTGCCTTCCGAACCACGAACGCCGCGACGCCGAACACCCGAGTGCAGTTATTCCGGAGCGTTTTTGCCT
TCGCTGTCTATATTCTGGTCGGGTTGATAGAAAAGGCCAACGCATGGATGGCTTCCTTATCGGCGGACAGGACGCCCCATCCACA