Description :
From Genome Similarity Track
Location :
Scaffold_479:6989- 13828
Sequence
6839 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACCTGGTAGCACTTGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGT
TCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCTCTGCAGAG
CCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGAGTTCGACGCGTATGAGCAGGGGCTCATCGCGCATGTGCGGGAGAACCTGCAGGCT
CCGTCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAG
AAGTAGAGCTCGCGATGGACGCGGCTCCGAACCCGACCGAGCAACTTCGTGTTGCTTTTGCACTCTCCAGCCTTAGCGGCCGTGCTAAGAGTTGGGTGTA
CACACGGGAAGCAACATGCCCTGGATGTTTCACATCCTGGGCTCAGCTGTTCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTATGAGTACCGCCAG
CGTTCGCGCTTCCTCGCGTGCAAACAAAAAAAGCCCCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGATAAACCCACT
CAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCCGCTGTTCCGGGTGCAGTCAAGCACCCTTGAAGATGCG
ATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCATGGCCTGAGAGTTCCTTGTCGGCTCCCGGTCGAACAAGCC
CCAACGGACCAGTTCCCATGGAACTCGGGTCCCCCGAACAGCGTGACATCCGCTGCTTCAAATGCGGGAAGATGGGCCACTTCAAGCGTGACTGTCCCGC
GGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTTCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCCGGGAACCAATAGGGG
TGGGGCGCCCTACTAGGGAAGAACTAAGTCTTCGTGATGGGGGCGCGGGTGGCGCGCACCACGGGGACTTAGCCCCTGACTGTCTTCGCACTCTCGATTC
GGCGAAGAGCAGCGGCGGGTTGCTTGTAGTACGCGAATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGATTCTGGGGCGTCGAAGAATTTC
GCACGCCGCCAGACGGTTGCTCGCAACAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGA
AGGTCGTCACTGTCCCTAACGTCCAAGTGGATCTGACTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCGTATGA
TATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGCCAGAGCA
TTGGTGAGTCATATTCCCACCTCTGTCAGGACACGGGGCGCCCGCAAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGTTTGGGGGTCGTCGACGTAT
AGGACGACTCCGAGGATGTTTTGATGGTGGCAGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGTGGGTAACTTAGTTCCGCAGAC
AGCTGCAGCTGTCACGAACACTGAGAACAGCGTGCTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGACGAGGAAGACGTCGGA
TACGCTTTCTGTGTGGGTAACACGGTACCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACATGCTTCCTGTGTGGATAACACAGTGC
CACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTCGAACACGCTTCCTGTGTGGGTACCACAGTACCCCACGAGGCCACGAGTGCCTCGGATGT
CGTAGCAACGACATCCCTAGACATAGGCAGCAAAGCTCCACGTCACGGTCGCCGTCGTCAACGACGCCGCCGCCGCTTCAAGTCGGATCCGAACTTCGTT
CCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCCGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACCGGTT
TACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGATGGCTGAGTCTTTCTCGGCCAACCT
CAAGGCTGGAGAGACTGCTGAGATGGTGCCCATGAGACCTGAGACCACTCGGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGAC
CTAAACAAGCAGCGTCAGACGCGCTTGGGTTCTGAGATCCTTAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACA
AACACCCACCGACCCAACTCCCACCGAATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCC
GCGCGAACAGTGCGATGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGCGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGC
GTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAGCAGCGCAACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGT
TGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTTCCAAATCCTGATGCAAGAGAGCGACATCCCGCTCACCGC
GGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTTACGCAATTATTC
CGCCCTTTGCGTACCTTCGTACAAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACAC
CTCCGTCGAGTGTTGGACGTAATGCGAGCAAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGGTTAAAGTTCTCGGTTGCTTCG
TAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAATGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTAGGCTT
GGCCAACTTCCTTCACAAGTACAGAGCAGGGTACGCGGGTTTCGCTAAGCCCTTGCCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGTGAGCAAGAG
CACCAGGATGATGTTGACAGCATCAAGGCCAGTCTCCAAGAGGCTCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCT
CCGATTACGCCTTCGGGTGTGCATTGCTGCAGGCCGACACGGCTGGACACGAACGAGTCATCTCGTTCCAGTCCAGGCAGATCAAAGCCGCCGAGCGGAA
CTACCCTGTCCACGACAAGGAGCTCCTGGCAATAAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCTCGGCCCTTCGTGATCTACACAGAC
CACGCATTCTTGAGGCTGGCGACAAACTCGCCTCACCTCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTTCGCAGAATACAACTTCCGCATCGAATACA
AGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCTGACTATGAGTTGGCCCACATCACACGGGTGACAACGGATCTATATGATCGGATA
CGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCTTTATGGCAGGAACGAGCGCGAGGTCCGACTGGCTCTCGTCGCGACAGCGCT
CACGGCTCCACCGATATGAGTTGAAGTATGGTCTCCTCTATTACCGGGTGGAGCCCAATGAACCTCCACGGGTGGTCGTCCCAACGACGAGGATCTGAAG
TTCGATATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGTCACTTGGGCCGCGAAAAGACCTTTCTGTCGGTCTCTCAGTCCATCTGGTGGACCCACA
TGTACAAGTGAGTCGCCCGGTACGTTAAGACATGTGAGACATGTCAGCGGGTCAAACTCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACC
AGCTGGCTGTTGGAAGTCGATGAGTCTTGACTTCAGCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGC
AAGATGGTAAATCTTGCTCGGGTTCCTGTCACTTTACGGGCGAACAAACCGCACGGTTGTTCATCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAAAC
GATTGTCTCGGACCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAAATGCTGTTTCCTTTACTAGGAACCCGTCTGCAGATGTCCACAGCGGACCATCCA
CAGACAGACGGCCAGACGGAGCGCGTCAATCGAGTGCTCGAGTACACTCTGCGCAGTGTGTGCGCGGCAGCACCATGTACGTGGTCGACGCAGCTTCCAG
TTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGCTCACGCCGTTCTACTTGAATGGCTTCCGTCACCCCAGAGTGCCTCTCACTCTTCG
AGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCTCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAAGTG
GAATCCTTTATGGATACCAAGCTGAGCGTTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCCGACAAACATGGAA
GAGGAGACTTAAGTATATTTAAGGTGGGAGACTTAGTATTGCTAGACACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGATGAA
GCACCGCTTCTTCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTCTATGTT
AGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGCTGACTCGCAGACCCACCTTGGCCCAGCTCCTCGAAGCTAAGGCCGGCCATAGATGTCGACGA
AGGCGTCGGAGCAGGCACCCAAGCCTCGGTATGAACGGCAAAGCTGCGGTCAAGACCGTACGCAGGAGGGTCTCTGTACGAACGGACCCCGGAGCCATAC
GCCGAGTACGTTGAGTACGCCGGGTACGCACCATACGCGTACGACTGGGAGTGCGCCGAAGGCGGCCCCGGACATGGCAGCAGTGCCTCGATCCGTCGGA
TCATGCGGAAGGCCTCTTCAACATCGGACGAAGAGGCCCGTCGGTCCACCCGCAGATGCAGGCTCGCGACATCACGCTCCAACAGGTCCAGGCGGCCCGC
AACACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCGTCGCCAGTCCCAAGGCCAAGTGCAATCTCGAGCACGAGGACGCGTTGACGGAGG
CGGTCAACCTCAGGGCCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTTTTGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCT
CCGCCCCTGTTGGACCGGAATGGTGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGCGTCGCGGTAAGTGACAGCTCCTCGTGAAGTGGA
GGGGTTATGCTCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTAATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCT
TCATAAGTAGTCCGGGGCTTCTTGCCCGAATGGGGTACGGACGATGAATACATTCCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGA
TGTCCCTTCGCAGCATGCGCTTGCCGATCAAGTGGGCAAGCCTCACACGAAGATCACGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGGTTTC
CGTAACTCCGAGGGTGAGTACTTAAGAGACACCACCCATGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGACAGCTCTCGGGCATAACCCACGGGT
ATCACCAAAGAGGATAAAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTGAGAGGGATGCGGTGTGGCGCGAGAAGCACACACCG
AGCAGCCTCCAAGTTGTCAGCGAACAACTGTTCTTTCTGAACAAGGGCACGTTCGTAGATGCCCCTAGAAGTTTGGCTGTCCACAAGGCCACGAGGAGCG
ACGAGAAGCTCTAGGAAGAGGTCATCCCCAGCGCTCTCCTCGGGAGGACAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCG
AACCCCCACGCACACGCTGGGCAGCTTGGAATTCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCGCAGCGATAGCACCCTCCTCCTCCTC
TTCTTCCTCCTTCTCCTCCTTTTCATCCGAGGAGTCGAA