Description :
From Genome Similarity Track
Location :
Scaffold_340:6989- 9029
Sequence
2040 bases(100 bases per row)
TAAAATAAGAGACTCTATGAGTCTAGCAGTCTTCCTCTGACAAAGGAGTAAGGGTAGCTCCGCTATACTTGGTAGCACTTGTAGTAAATCTACACCTGAG
TCTGTTAAAGACTGTTCCTCTATAAGGATGGAAACAAAGATAAATCTCTGCAGGGCCCAACGATTAGCGCTGGAGAAACTCAGAGCGCTAGTCAGGAACG
AATAAGTGGATTTAATCCTCGCCTAAGGTTTTGATGTGATTCGTGCACGTCTTGACGCTTTTATGCAGTTTGAGTCCACTTTAATTGGGCAAGTACACGA
CCATTTGTCATCGGCTATGCCTACTCGGTATGTTCCCATACCAGATGAGGAGCCAAGGGCTTGCCCACTCGACTGTAAAGACATTTGAGGGAAAAACGGG
TGAGAATCATCTCCTGTGGATCAGAGAGGTATAAATGGCCATGAATTCCGCTATGCTCCAATTGGAGCATCCGCGAGTTGGGATGACTATCTCAAAATTA
GGTAGTCGAGCCAGAGAATGGCCTTGCACGTGTAGCACGTCGGTATACGAAGCTTTCCTCACCAGAGTTTGCTAAAACAGCAAATATCCCGGGTGTTTGC
TCCGCCTAATCAGTCATATCGAGTGCGTTCTCGCTTCCGATCTGTCAACCAGGGCAAGAAAGAGTTATCGGACTATGTCCAGGAACTAAGAACTCTAATC
GCTGCCATGCAGCCTAATCCCTTACCAGAAATGGTTTTGGTTACCATCTTGATGGAGGTTCTTCTTACTGGTGTGGCTCGAACGGAAGTATTCCTAGTCC
ACCCCACCTCCTTTGAGGAGGCTAAAGATATCGCGTTAAACGCTGAGTTTCAATTAAGCTAGCTCGTTTTGGTACCCATGGGTACAACTCAAGTTCAGCG
AACTCATTTAGTTGTTCATTCAATCGTCTGGAGTCTTTGGACCTCAGTATCGCCGATACGGAAGAAGAAGCAGAGCTGTGAGCTGTAGAACAACATTGTA
ACATTCGAAGATGTTTCACGTGCAGAAGCACAAAGCATCTGCGACATTTATTGCCCTTTACGCAGGGCACACCAGGCTACTTCGGACCGAACTCCCGTCG
CTAACCAGAAGTCTGGTATGGTGCGGGAAAACTTAGACTCCCAGTAGGCGCAGGACGACCTGCTGGGGAGGAACTAGGTTCTATTGAGCCTCTAGGAGGG
AGTGACGAGCATAAATTAGCCCAAAGGAGTCCCGTGCACTCTACCATGGGACGTGAATATAAGCCAGGCTTGTCGGTGGCAAAAGCGACTGTTAAGGGCT
TTGACAAACCCCGGTCGATTTTGGTCGACTCCGAAGCATCCGGTAATTATGTCAGACGATTTTCCCTTGAAGGGAATCCACGTTATGTTGGGGCGCAAAG
AGCGCACAAAGGTGATACGAACACTGTTCGCTTGGCGACAGGAACTCTAGTCACCGCACACAAAGTTCCTGTGAACTTGGGTGTGTAGTTTTTTGATTTT
GATAGTATCGAACGCTGCTTAGTCCTTGATTTGGACTCGAGATATGATCTCATTTTTGGTATGGCTTGGCTTGAGCGCCATGAGCCATGGATCGACTGGA
GGTCGAAACATTAGGCGCCACACGCACTGCCCCTAGCGGAGCCTTGTAGAGTCATGAACCCACTTCTGCTAGGAATCAGACGCGTTATTGGTGCGAGCCA
CTGGCTGAAAATGTCAGTGTGCTGGACATCGGAATGCCAGAGTTAGTTGATTCTGACGATGTCAAAGACATGAGTATAGAACAAGGCTCAATATGTGATA
GTGAAGCGGCACGTACTCCGCGATAGTCGTTACGTACTGAATACTGATAGCATTGTTGACTAAGCGTCAAGTCATCGAGGGTTGGACCCGTCAGATGAGC
GTGGAGTGGCACGCAAGTACCCACTCAGTGACGTCGGCTGTGATAGCGATGCGCTGAATGTCAATGTTAACAATGTTGGTCAAATACTAAGGCATCAGAG
CCCGGCTCAGCGGATGCGCGTGAAGTGGCACGTAATCTAC