Description :
From Genome Similarity Track
Location :
Scaffold_608:6989- 18374
Transcript NameFunction/comments
Phyag_g6988hypothetical protein
Phyag_g6989hypothetical protein PHYSODRAFT_560624
Phyag_g6990hypothetical protein PHYSODRAFT_508787

Sequence
11385 bases(100 bases per row)
TTGTTGTCGATTTTGTAGACGCTTtcgcttccaccaccaccgctggATGGTCGTGGCGTATGCGTTGTTCCACATGTGCGTTAGAATCTCCTGCCGCCGC
TGATCCTCCAGTCGGACTTTCAATTCGTAAAACTGAGCTCGTGCCTGCTTAGCTCGATAAGCATTCTGCAGTAGCACTGCGGCGGCTGTTCTTCTCTTTA
TAGCGATCGTCACACGCTTGCCAAAAAAGCGGGTGAATTGAACGTATCGAAAGAAGTTGAACAGTACCAATCTGGCGTTTGCTCGTTTGTCGCGTCTGGC
TTGGGCACGTGCAATCCGTTTTCTCGTTCGACGCATCCAAAGCTGAATTGCGATTGCTGCATGGTACTTCACCAGATGATGGCACCAATTGATGAAATCC
CGTTTCTTCTCGATGTAGTGTACAAAAGCACGCGTAATTACACgtgctgcttcctgctgcttcatccaaACTGCACAGCGCACTCGAAAAATGTACGAGT
GATAGAATCGCTGAACCCGATGGGAAGCCACGTCGTACGCTAAGAAGCGTTTTCGCCGCTTGAGCATTTTTCTGGAGTGAAATCCTCGCCAACCGGCTTG
GATCAGTTTCGCGGCTTGGTGCAGGTGATAGACGGCTGCGGTGTGTTTGCCTCTCATACCGCGTACCCAGCTTTGAatgtcaactgcagcagcagtagct
tcGACTTCATGCTGATACGCAATGTTCGCCATCCATCGGCCCCACAATCGAAACACTACACATTCGAGTCGCTTTCGGGATATCTGAAGAACAAATAACG
CACATTTACTATTTGCAAGATAACGAGTTAGGCACGCTAATTACTGGAGCATCACAATGTAGCTACGGGTAGTTGTAAACGTACAGGCGACAAAATCGGC
GGACGTGTTGGCGGCATTTCATCCACATCATTTGCTGGCGCCAATGCGTAAATCGCCGACGCTTGGACTCGTGACAACTTCTTGAAATTATGATCTGAGC
AACAGTGAACGGTGAGATCCAACCGTTAATCCAGGCAGATCCGACATAGGGGTTCGTACCGATAGCTTTTCGACTGCAAATTGCTTTCGCATGCTGATTG
AGCGAGTAACCTCTTCCATACAATGATCGCGAACCCATTCACGAATGTCGGGTGGGCAGATTTCCACTTTTGAAGATGCAGGCGACTTTGCTGAGGCAAG
AACATTATTCGTTTTGCTTGGTATCCTTGGTTGGTTTTGCGGCAGCTTTGTCTGCGTTGCGCGTGGCGGTCCTCTTTTACACACGATCACCTCTGGCAac
attgagctgctggtacGTGCAATTGGTAGTACTCGTCCGTGAATCCACGCATTTCGTGCAAGCTTGTCACACAACGAAGTGGGCAATGCTTTTCGAGAAT
GAGCATGGACCCACTCTTCTTGCCGACGAAGCATAACGAGagccatctccatctccatgacTTGGTCATACGTTAGATTCATTTCTCGTAGAAAGCTAGC
GCTTTCTAGCGTACAGGCGACATTTGGATGTGAAAGCAAAAAGAGCACGTCCTCAATCGCCAAACACTTTAGACGAAACTTGTCCTCCCAAAGTGATAGT
ACATGTCCTCGTAATTTGTTAGATGTGAGCAGTCCCGCACTCTTATCAAAAGGCCCAACGAGAGCTTGTTTCGTGGGTGTACCAACTACCGGCGATGCAA
CCAAAGAACGGGGAGAAACAAGGGTCGGTCGAAATGGCACCACAGATCTGTTGCACTTAATTCTATCATCTCGTGTACGTGTTGTCTTTCGCTTTCTGTC
GTCGCAATCCTTTATAATCGGCAGTCTGGGCTCCAACAGATATCTTGCTTCACTTAGATTCCTTTGTTCAGGCAAAATCTCGTCCAATATGCTTGCCACA
CTCCATTTCCTCCCATTAAGAGTGTTGAGACGAGCGATCAAATTATCAAAGCCTTCAAAACCCGCCTCTCGTTCTTGCATCGGAGGTCGTGAAGTTGACT
GTCTCTTCACATgagttggtgttgatgaCCGCTAATTTTGGGGCTCAGCTCGCAGGTTTAGCTCCTTCGCCTCCATAAAATCAAGGAGTTCCTGGCATTC
TTCTTCACTCAGATAAGGACGCAACATACGCAATCCGTCCATGTATAGTTCTTTGCTCCACGCACAGGCCGCAATCCCGCGGTACAACACCTTCTTTGCT
GCATCAACCTTCCCTAGCGCCACCTCAAAGCGCATATACAGTCTCCAGCAGAGTGCGTTGCCTTTTGTTCGAATTTGATTCACCATCCCTTCAAACATTT
GCCGAATACGAGTGACTGCAGTCCCATTCATACACCAGCGATGAAAGAGGCAGCAAGTTGGGCGTGACGGTTTGTTAGCACTCGACTGAACAGTATCTGA
TAATTCTTTAATCGTTGCGGCTCTCTCAGCTCGGCAAACTTCACAGAGCAGTGCGAATAACCATTCCACCAATTCTGGTGAATCATAgtgtcgtcgccat
cgcttTTCTACTCGGAGGAAGTAGTTGCGAAGCACCTGCGAGATAGTATTCCCCGTTTCGGAATCGATAAAGAGCCGAAGAAATAGTTCGTTATTCGGGA
ATTTCTCCACAGCTTCGCCGATTGACAGACGCCATTCACGGGGAGAAACCGCGGGGAAGGAATCCGAcaattgatgctgctgcatgaaTTCCAGGAAGCA
AGTCCACATCCATGCTAAATTTGAGCAGGTCTGGTGCTCTACCTTCGCCAACGCTTCGCGATATTCGTTGCAAGCTGCTTTAAATCCGTGACTTGCATAC
ACGGCGAGTGTTAAGTTGTGCAAGCAATAGCCAGCCCAGCAACCCGATCGGCACAGGGGGCTATTACTTGCATTGCAACTCTCGGGACAATGCCGAACTG
CGAAGTCATACTCCGCTCGATATCTAGCAATGATATTTGCGCCAATTGACGGATCGGAAAGCAATCGTTCATGCAAGTAGTCGAGAGTATGTTTCCGGTG
CTTTTTCGTGATCGCATCCAGTgtttccttcttcttcccgtGTAATTGTTCAGGTTGCCACACATTCCAAAGGATATACAAACACCGCAGCAAACGGAGG
CGCTCTTGGAGACGAGTCGTCTCCTGTTCAGCGGTGGGATGCCACATCTCCAGTCGGGTCCGAAGAAAGACAAAGCGATGAAAAGCTCTAGCCACCAACG
TGTTGTTTGGGGGTGGAGTACCGAGTGAATTGAGAGTGTTCTCGCAAATGCGCTTCACTTGTCGCTTGTTTCCCAGCTTCAGCTCTAATTTGGCGTAGGC
AAACAGCACGTCAAAATCTGTATCGCCGTTTGTCGTTTTCAGGGCTAAGCTTTGAATCAAACGTCCAACATAGGtttggctttcttcttcggcattAGAT
GCACGAGCAACATCAGCTTCAAAGCCAATCCACATGCACTTTAACGTGCTTCGGAAACCCTCATCTCTGTTGTGGAAGACATCCAACGATTGCTCAAAGA
CTCGGCGCACAAAAGCCACCTTGCTGGGATCGCGGAGCACACCGTTCTTTACTGCAATGTCATATATAAGAGCGCtctcaagcagctcctttCGATCACC
CGGAGCAAGAAACAACGTCTGGTTTTTGGAGTGGTCTGCTTGAGGATTGAGTGCAGATAGAATAGGATCCACGAGAAGTTCGTAATCTCCAGGGCTGTCT
GCGTACAGTGACTTGCAAGTGGTCCATGAATATTCGCCACGCCACTCTACACCACACACTTGCAGAAGCTCACAAATAAGTCGCCACTGGTGTGCCACTG
GAACAGGAAACAAAAATGGCTGGATTTCTTCTGTCAGGGTGGCCCGGTCCGGTtgatgctcaagaagatcttgGTGGAGAGGGTTGTTAGAGCGCAGCGG
GGCCCATTGCAATTGTGTtagctcttcttctcgcttgAGCCACTGCAGAAAGGAGTCATTTTCATCGATGGAATCATAATTCGCACGTTGATCTTCCACC
TGCGattgtgttgctgcaaacACTGCGTTTTTCATCTGTTCTCTTTCAAATAATTGAGTTTGACGAGCACGACCACTTTCCGTACCACGTAATTCGCTTA
GAATACGCTCGTATTCTCTGGTgtcatcagcttcatcaacaTTAATGCGATACCCGTGTAGGTTGCTATAGATGAATTTTCCCTCTTGCCTGGATTCCGC
ATCTGACTCATCACTAGCCGGATCTGTtggccttgagctgctgttgtcTTCTATTTtgtctgcagcttttccttTGTCAATTGCAATCGACCGACGTTGG
tatgctgcagaagcagacagCAGCCTCTGCTTATGCTCCTTGGTATTCAATACTCGAGGAGGGTTCAATTGATCGACAGTTGTAACACAAGTTCTCTGGA
TGTAGTCTTggaactcagcagcagaaatctGCGGAGGTTCTTGCTCTAATACTTCGGTACTCGCCACAGacttgttctgctgcttaTCACCAATTCCCAC
CGCGTCATCCTCATTCCATCGTGAAGCAAACTTTTGCAAGGTATCCAAGTGAGTTACTTTACTGCTATTCCTCGCAGCCACGATTGGCTTGGTCACGCTA
AAATCAAGTAGAGCTTGCAACTGAGCGATTGAGCGTTCGACATAGCCTGCCTTCTTCTCAAATATGCACATGAGGAAGTGAAAGTCCAGTAGCAATGCTG
AcatttcctcctcttgtGCGGCAACAGATCCCATGTCAGTCATTTCATTCGATGGTTTTTGTGCTGACGCCATCTTTTCCGCAATATTTACACTTTCTGT
CCTCAAAACAGTCAGAATACGCGCGTACAGATCGCGCATTGACTGCATTGAAAAACTGCCaaagtgttgctgtcgaatTTGAAGTAGCTTGAGCCATAGC
TCGCTGTTTGTAAGATCTTCAGACAGGAGACTCTCCAGCTGTCGCTGAAACAAATCGAAGTCATCATTTCCACTCCTCGGTTGAGATTGCAGCGACATGT
TCAGTTTCACATGATGCAGCTCCCGCGATTGAGGGTTAACCGCGAGGGCTCTTGCTAGAATCGCCGCTTGCTTTTCCACAACACTAGCTCTCAATGCTGA
AGCCATTCTCCCGCTCTTAGTTTGAAGGCGAATCGTCTGCTCTTGGAAGGCAATCAAGTCGAGCCAATTGTTCACATCTTGCGGGTTTGCGGCTACAGCA
GCATTAAGCATTTTGCTGCGAACCACTAGGTGCTGTTCCACATTTTGTCCGTCAGTTAGCAGAACTCCATTGGTGTCATCATGGGCACCTGGGGCATGGT
CCcgcgccagctccttgtcgtccagcatcgGATCAAGAGGAATGAACACCATTTCGGGTGGATGGCTCGTGACAACAGTAGCAGTGTGGTTCGACTTGTT
ATTGAGATCCATACTGtcctgagctgctgcgcgtccCAATCGCTTCTCTGAGTAGGCAAGATACAGACGCTTCTGTCGAGCATCTCTTTCCAGTTTGCGT
GCCTGCAGCGAGAAATATCGATTGGAGTTGTaatcttcttcctgtttgtGAGgtattttgctgctggtataTCTTGGCCGTGTTTGGGATATCCAAGAAC
CTGTGAGCAGATTCCGTCGCGTAGCCAACTCATAGATCGGTTGATCATGGGCATATGTCGATCCAAAAAACTGGTTGTCGCGGTCACCCACGCAGTCGTA
CTCAAAAAGtttgtcttcatcatctACCGCAGCTTGCCCACGAGCTACAACGTGTTTGGCAATTTGTTTTACGATCCGGTTCTCCTCCGTGCGTCCGGGC
GATGGAGACCGAGACCGAgagcgcgagttgctgcgATTGCGACGTCTTCGCcgtcgatggcgatggcgatgactGGGCCGGAGGGTCTCATCATTGTCAT
CACTGCTATCTGATCGACTCCAGGACCGGcgacgcttcttgtccttgatcttcttcttgtgtttAGATAAATGACGACTCTCACGCGACGTCACAGTCGT
CGATTCATcattgcgctgcttcttctctttgtGACTCTTCTTCGATTTCTTATCTTTGCGGTGCTGTTGGCCATGTCGATGTTTGTAAATTTGAAGTGCA
GACTCTGATGAATCTTGCATTGCTTTGGTAGTGTCGTCATTTTTGCCAACAGTGGAGAAACTCTTGCCAATACTCAGCCAATCTACGTAGCGAAGGACAC
ACAAAAAACCTTAGCACGACACTATATGCACCATAAACAAGCAGCATTCCTACCGCTAGCAGTCTGCGCgttgccttcttcacctgcaTCCGACGCCACT
GCCTTGCGCCCTGCTGCAAACATGTCCGCAATTTGGTCAATTGTGAATATCAAATTTGGTAGATTGCGATACATCAAAATATAGTCCAATAACACATTTT
ATAGTCCTCAATATGCACGCATTCAACGATTAGAGCAGCATGAGTGACGAGAAGCTCGCAACGCTGGCGCCCACGGACCTGacggatgaggaggaggttt
CTGCCTACATCAAGCAGAAGATTCGCGTCTACAACAACTTCCCCAAGCCAGGAGCGGACTTTAGCGACGTcacctcgctgctgctggacccgGTGACCTT
CCAAGTGGCCATCGACGCGCTTAAAATCCGATACACGGACCAGCGCATCACGCACGTGGTGAGCTGCGAGTCCAGAGGGTTCATCTTTGGTGCGCCATTG
GCGTTGGCTCTTCAGGCCGCGTTCGTGCCTGTGCGTCGAGCGCGGAGACTTCCTGGGGACGTCGTGGGTGTGGACTATGTGTCGGGCTTCTACACCGGCC
GCATGGAGATGCACCAGGATGCCATCCCGAACGGAGGACGCGTTGTGATCATCGACGACCTGGTTGCATCGGTGCGGCAATTTGCGTGCATATTGTGTGG
AGCTACTATTATTTTGTGCTCTTTTCGGTAGTCGCAGAAAGACTCAGTTGCTGTGCCGTGGTCGATTGTTGTTGCATGCACATTAGGGGAAAACGCTCAA
GGTGAtggtcgagctcgtcgagaagctcggtgGAGAAGTCGTGGAGTGTGGCTGCGTGATcaactcgctgcagtcgacggTGCGTTGCCTTGGTCTGTCA
ACCTAGGTGGAGATGCTGTAACTGCCCACTAACTGCGTGTAATGCCGTATacaggaagcgctgcagaacaTCCCGCTGTACGGACTCACAAAAATGTGAG
CATAGAGTGCATTCCGTAGAGCATTCATCTATCTCGCGCTGAAGCCCGAACTCTCTCGAAGTCGACTTATTACAATGTGATAAGGCACAACTGGAATCTT
AGGTTACGGTAAAAGATCAGTTTAACAGACTTTCGACCCCATCCATACTGAAGTCAAGTCAATCATCCGGATACGTTCCTAAATTGAATATTTACTTTAG
CAGAAAAAGGTTCGTTTTGATGACCCCAGTTTGTTTTGTGGAACCGGTGCTGGAATCAAAACGGAAAACCCCGCGGAGAAGCCGAGCCTCTTCCTGCCTG
CAGAATGCCGCCCAAGCAACGTATCCGGCAGCGCTTCGGGCCCAACCAGGACTacctgctggtggtgcaggtgaaCACGGACCTGCCGTTTCGAGCCCCG
TATGGCGGCCTCATGGCCGGCTGGGAAAAGGTCGCAAATACGCTCAATGGATGCAGCGCTTTTAAGATGCACACCCTCAAGGGCCCCATTGCCAAGAACC
GCTTCGAGCGCCTCGTGGCGCGTCAGCGCGCGTGGGTAAAGAACGGCAGCCACCCGGATGACGCGCCGTCGCAGGACGCCTCCTTCCAGAGCGTCATGGC
CGAGCTGGTGCCCAAGCTCGACGCTGCGGAGGCGGAGCCATTGACGCAGTCGACGGGTAAGCGCGGCCGCCCGCGAAAGATCCGAGCGGAGGACGGACCA
GTTCCTCCCCcacagaagaagcaggcggTGCAGCCCGCACAGGTGGCGATCGCTCCGTCACCAGTGGGGCCGCaaccgtcgtcatcgtccacTTCGCTGC
TCGTGGATTCCGAGGATCAGGCGCTGCCTGTTGTCACTAAAGCCACCCGCCAACGGTTTACTCCTGGAGACGACCTCCTGCTCGTCAAGTTCGTGAAAGA
GACGCTGCCGTTCCGTGCCAAGTTCGGCGCCATCTCGGCGGCGTGGGAAGATGTGGCGAACAAGCTGGACAACAGTCCCGAGTTCTCCAAGGACAACATC
AAGGGCCCCATCGTGCGCTACCGCTTCGAGAACCTCGTGTCCAAATATCGTGAACGTGTCAAGCGTAACAGTGGCCGCGTTGTGGGGCCGAAGGGAGCtc
ctgctggagaacttgaaGTGCTTATGACTGAGCTAgtcacgctgctggatggtgGAGACCCTGTCAGCGCTGCTCTACTCGCGCATAACGTGGCGCTTGC
GACTGGTGCTGTTCACCCAGCACCGGTAGCACGAGAGGCACCTCGCGTATCTGCGAgccaggacgaggagacttccagcaacgccagcaacgccagcaac
ccGTCGTCGCCGGTCTCCACAGTTTCTGACGATACTGCACCTGCCCAGAGCTTCATTGCCCCTGCCCCTCAGCCCGAGCCGACAGTGGCCCCAACGTCAA
CGAGTTTgtcgaccaccaccacgtcgtcgccgacTACGACTGTGGCCACGATCTCCGCAATGTTGAATGGCACGGAGCCTACTAGTATCGCTGAGCTCAA
GACACTGCTCcaagaggtggtggagcagcaggcacAGGCCACAGAGcagatggtgctgttgcAACGTGAAGAACGTCGTCTGGAAGCAGAGCGGCGAGAA
CGGGAGATCAAGATCGAGCGtgaggagcgcgagaaggaCCGCAAAGCGCTGACTGCCACCATCATTTCCGTCATGCAGACGTTCCTCGAGCAGAACAGCC
GCGAGGACTAAGGAAGGGTTTGTAGTTCATATAAGGGCGCTATCGGTCGAGCAGTATCTCTGTAGCACACTGCGGGGGGGCTTGTAGGTTTTGCCCCCGT
CCATTAAGTTCACTGCATGCCTTGGACACCTGAACAtcggcgtcgacttcaaAGTATCAGGTGACGATTTGCGGGCATCTTTCTTTCACAAAGAAACCCC
AGCTGGGCTGATCATTCTTTCCCTCGCCTCGAGCCCACACTTCTAAAGAGCGTCTCTAAAGAATCGATAAAAGCAAGAATCAACCATGCCAGACAACGCA
GGCACATGCTTCGCAGGCACTTGCTGCGCGACGTGttgcagtggaggaggaaccTCCGCAAACGACAGCagtcgtcgacgtctcgccgacgacgaccccC
GCCGCCGGGACTACGATGCGTCTCGCGATGTTACTGTGCAGCCCGTGGTGATGTCACAAATCCGGCCACCGCAGCCCCAAGTGCGCGCCAACGCCTGAAG
AGAAGAGAAAAAAGAGAGTGACGCAGCGGCAAGGAGAGGATGAACCCAAGGTAGGGCGCAAGGactaagttgaagtggagagcgttgctggagatggctA
CGAACCAGGAAGGAGCAGCACATCAGCGATAATGAATATACATGCACTGCATAATGTATTGTCGCTCTGCTGGTCGGACAGGCGTTCTCGATGCACAGCA
CCTGTGCACAAAGCTggtcgctgcagatgatgaTACGAAGGCGTGGGTGAATTTTGGCTGGGCATCAACCAGCGGCGCGTTTTTGCTGACGGTAGCTGCG
ACACAACCCACATGCAGTGAACAAGTGTGCACACGTCGCATGTTTGATGAAAATGAAAGCTGCTGGAATGCTCTAGTTCTCGTTTCGCGGCACGCGTGGC
GATTCTCATTCCGGAATTTGCCGGCGTAAGTCCAAGAAGTGCAAGAGAAGACAAGtaccaagctcaaggagcttCTGAGAGCGTAAAGCTACTAACAAGC
AACAAACACCAGCAAGACAAGCATGTGTGGACCTGACGACGGCCCCGatggatgttgctgctgcatggaCGACTGCTGCGGGTGCTTGGCCGGCCTTTGC
TGCGCCTCGTGCTGTCTTGCGGGAGCTTCGGCGGCAGACAACGGtgatcgacgaggacgaggcggcTACGATTCACCTCGAGAAGTGTACGTGCAGCCGG
TAgttgttcagcagcaaggccCGCCGCCTCCTGGATATGGATATGGACccccgccaccaccgcctcctggATACggtcctccacctcctcctccacaccG
CGAATACTACTAAagtacttgtccagcgcgTTGGCTCTTCTTGAGCCACGCAGGACAAAACAGGCTGAAAACGCCACTGATTCCATGCGAGGACAGTAGT
TGTAAAAAACTACATAAAACCAATAaaaacgtcgtcgtctttcaTCTCATCGAGGGCGCATGGCAACAAGTCATGCGGCTGCCTGCAGCTTTAAAcgtgc
atgttgaagtgtcATTCTCGGATTTTTGGAATCAGATTCAGATTCGCATAAGAGGTCTCCACAGAGACTGATAGCATGGGAGGAGAGACCGTGGTGGGGA
CTCGCCTGCATTGGCACAGCCACTCGCAGCGCGACCGCATCGACgtggacaaggtgctggGTCAAGTTCATGGCTTTTGCTCTCGTGCCGCGACTTACTC
CGATGGCGGAATTCTGGTAGCGGTGGGGCTACCGGAAGCGATCGCTGGAACGATACCGTCCGCCCATTCGTCgccctcgtccagcgccttcatcgaCTCC
GTGCGCGACTTCATGACGCGACTACAGAGTGAAGTAGCTGAAGGGACCTTGGCCGGCAACGTGAAGATCATTCCAATGCTGCACTGGGGGAAGTTCGTGC
CAGCTCTGAATGCATTGATCGGTATCGCTGCTGATCATTTCCCCAAGGCCGACACGCTGATCCTGCAGTCCCTAgagatcgacgtggacgctACCAGTGT
GGCAACACTACGCTCGCACTTTGATATTAAGCGCGACCTCGTGGTGGGCGCAGCGCTGCCCGGCCACGACTTCCAACCAAACCCAGCGACCCAACCCGTC
GAGCTCGGCGGCCTGACGTCGCCCTGGAACACACTCGCGCTTTGGAACCTGGAGCAACTGACGAAGGTGGGCTTCGCTCTGATGGGAGACGCGTTGCGCC
TTGGAGTCGACGGGATCGGCTCAGCTGCAGGCATCGAGGAAgtcgccaccatcgcaaTGTATCAGCAGCTCTATAGTACCAACAGTgcggcaccgacgac
agcCAAGTTGGTGCGAGTGCCTAGCATTGCGTGGCAAGTGGACGGGCTGCAAGACCCCGAGCGTCTTGCATggcacgagaagaagatggccagcaagcag
caacgtgcagcCGCGCAGCTCGCCCACTTTGGCGGCGTCGCACCTGGCCGCGTGTATCACGTGgacgcttgaagctgaaggttAG