Description :
From Genome Similarity Track
Location :
Scaffold_12:69888- 74898
Transcript NameFunction/comments
Physo_130595Os02g0776400

Sequence
5010 bases(100 bases per row)
GGATATGAGCCCAAGGCTCACGCGTGGGGAGCACAGCAACTAGGACGTCATGGCGGATCAGAAGAAGACGCCCAAGGAGTCACACGAGCAGAAGAGGATG
ATCCCGCCGTTTGACGGCAAGGACTACGAGGTCTGGCACGAGCGAGTCAAGCTCAAGCTGGAGAGGAAGAAGCTGTGGAAGTACTGCATGGAGGACTTGC
TCGAGCCGGACGAGAGCAAGGAGGCAGAGGCGCACGCGACGTGGACGAGCGAGATGGCCCACGCCAAGGAGATCATCTACGACGCAATGACGAATCACAT
AATGAAGACTGTGAGGTGTGAACCCACCCCGTTTCGTGTGATGGAGCGCTTAAAAAAAAAGATTTATGGGCAAGACGTACCTGAAGTACGCTGAGGAGAG
GGCCAAGCTCAGTCAGCTACGGCTCGCTCCCAACGGCAATGTGCCAGATCACCTGAGCGAGATGCGTCGGCTGATGGAAACCATTGCTGGAGTCGGGCGT
CCTGTGGACGAGTATGTAAAGCCAGCACTATTGATTGGATCTCTGCCGCGCGAATATGATCATGTTGTACAGACGTTTCTCGCCAGTCACAAGCCCCAAA
ATGCTGATGATCCTCCTAATTATGATCAACTTGAACTATGGCTTACGACCATCGCCAAGGTCGGAAAGCAGAGGGCGCCAAGGACAATGATGATGAAGAA
AAGGCGTTCTTTGCTGGTGGAGGAAGCGGTCGAGGACGTGGTCGCGGCCGTGGACGTGGTGGTCGATCTGGAGGACACGGGCGCGGTTCCGGTGGTGGAC
GTGGTTCTGGCGGTAGCGGCAGCCAAGGTGGTGGACGTGGAACTGGACGTGGCAAAGCCGGCAGTGGACAAAAGCCAGGTGGTGCTTGTTATCACTGCCA
TGAAGCAGGGCATCATGTGTTTGATTGCCCGTTTCTTGGCAAGCGACCTCCAGCCGAGGATCGCAGCAGCACCCAAGCTCAGAAGCGCGTGAAGATGAGT
GGAGGAAAGAGTGCTAAGGCTGCTGAAACGAGTAGCTACGCTAATGAAAGTGATGACAGCGCGTATGTTATTCTTCAAGTGATGAAAATGAAAAAGCCGG
TCGCAGACAAAGCCCATGATAACCGGTACCTGGACTCTGGTGCATCGAGTCATATTTCGAACCAGCTCACTGATTTCATGGAGTTCACGCCTCTTAGCGC
CCGGATTCGAGTTGGAGGAAAGAACTCGCTGGGTGTTGAGGGTATTGGTACTGTGGTTAAAGAGCTGGAGACTACTGGTGGGAGGTGCTTACTGACGCTG
CGAGGAGTTCGTTATGCTTCAGAGCTGCAGTGCAGTCTCTATTCTGTGCGACGGCAACTGAACCAATATCTGCCTGAACGTGATCGTGTGAATGTGCACT
TTGATGAGGCAGATCGCGCTGATGTTATCTTACAGGCTGGTGTGACTACCGCTCAAGTTGATTATACCAATCTCTATCGCTTGAAGTTGGAGAGACCCCA
AGAGGTAGCCATGATGGCGCCACCAGCTCGAGTGAGTAGTTTGGAGCTGTGACATTCGAGATTGGGGCACCCTGGCAGATACTCGTTTAATGCGCTGTTC
AGCTATGATCAGTGGCCGTTGCCACATGTGAATTTGCGTATCCCGGTGGGTTTCAATTGCGAGACCTGTGTGACGGGGAAACTTACGAGGAAGAGCATGA
AGAAGTCTCGGACACAGACCCGCGAGTGGTTAGTTGGCGAAAAGGTCCATGTGGACGCTTGGGGTCCGTATGCAGAGCACTCCTACGGTGGTAAACGGTA
CTTTGCCGTGTTCGTTGATGATGCGAGTCGGTTTGTCACCGTGTATCTTCTGGAGCATCGTTCGGAAGTGTACCAGAAGTTTGAGGAGTACTATCAACGC
GTCAAGACGCAGCAGCATGTCAGAATGAAAGCGCTAAGGTCAGACAATGCAAAGGAGTTCAAGAAGCTGCAAAGTACGTGTGAGACGAAGTATGGTATGG
AGTTTGACAGCAGCATCAAGCATACTCCGGAGCAAAATGGTGTCGCGGAGAGAATGGTCCGCACCATTACGGAGAGAATGCGATGCATGCTCGTGCACTT
CGACCTGCCTGAAGCGATGTGGGGTGAGGTAGCGATGACAGCTGCATACTCCGTGAACATTATGCCAAGCTCGGTTCGAGGCATGGAGGTACCGTATGCA
GTATGGCACCGTCAGACTCCTGCTTATGAGAAGTTGCGGACGTTCGGCTGCGCCGTCCTGTCGTACATCGACAAGGTGGAGAGACGGAAGATGCAGGCGA
AAGCACGGGAGGCGGTGTTCGTTGGATATTCGCGAGAGAAGCGAGGCTATCGCTTGCTCGATAGCAAGACCAACAAGGCCTTCTACAGCCATACTGTCGT
GTTCTATGAGAATAAAGCTGGTCGATTGCTCATGGACTCGGCATCAACGCCAAGTCCAGCCTCCGGTAAGGAATATTTAGGCGTTGATCGATCAGTAGAG
GATGACATTGAGCCAATGCTGGATGAAATGCGTGATGACTCAAATGATGGAGGTAGTTATCGTGATGATGGAGATTGCTGGACTGGTGGGGCCAGCGACT
CCAGAGACGGAGGTGATTATCGGACTGGTGGGGCTGATGACACCCGATGTGATGACCGACCAGGTGGGGCAGTTGAGCAAGATGTCCGGTCAGATGGGGC
ATGTGGGTCCAAGAAGAGAGGCCCCGGTGGTGATGCCGCAGCGCCTCGACCAAAGAGAGTGCGGTTTGCGGTGTTTGAAAGTGGACGTTCTAGCAAGGTG
GCAGAACGAGATGAAGGACGTTTAGTGAGCTCTACAGCATCTCGATGTGATCGTTCTAGCAAGGTGGCAGAACGTGATGAGGAACGTGTCAATGGACATG
AGGCAGACCACCTGCGAGGTGAGTGCGTGCCAGGCAATTCCAAAAGAAGGAGAAAGAGGAAACGCAGCAGTGGGCGGCACAAGGGACCGGCTGCTGACGA
GACGAGGGCTCTACCAGGGAGTCAAGAGGTGGAAGAGGTGGACAGCAGGTCATCGGCTGCTGAGCGGGCCGACTCGGACAGCCAAGTGTCGAGTGATGCT
GCAAGTATGGGGCGTCTATCAACGCCTCCTTGCACAGCACTTCGTGAGTACACAGGCCCGAGAGGCACTCGCCATAAAGACACGGAGCGGTCGGGTAAGT
AAACCGCCCACGTGGTTCGGTGACTACGTCTACATTGCCTACGAAAATACAAATCCAGATGATGATGTGAACTCGTTGCCTGCTGGATGGAGGAAAGCAC
GAGCTGAGTTGCAACGTGCTGTGGCGAACGAGTTGATCCTTGCATGGTGGGAGGACTATTGCTGCATGAGTACTGGCGAGTTTGAAGAGCCAGATACTTT
CGGTGACGCTATGGAGAGTGAGCACTCATTGCAATGGAAAAATGCAGCTGATGATGAATTTGATTCGTTGATGAAGAACGATACCTGGGAGTTGGTGCCG
CGTGAGAAGCACGTGAAAGTGCTGCAGAATCGCTGGTCTTTCGCGTCAAGTACCTAGCGAACGGAGAGATCGAAAGATTCAAAGCGAGGCTCGTGATCAA
GGACTTCATGCAGATTTATGGTATCGACTACCTAGAGATGTACTCGCCTGTTGTGAGGCTGGAGACACTGCGTGTTCTTTTGACACTGGCGGCTGTCTGG
GATTATGAAGTACATCAGATGGAAGCCACTACTGCTTTCTTGAATGGGGCGATTGACGTGGAGGTCTATATGGAGCATCCTGAAGGCTACAAAGTGAAAG
GCAAAGAGGACTGGGTGTGCAGATTGAAGAAGAGCCTGTACGACTTGAAGCAGGCGCCCAGAGTGTGGTTTCAGCTGCTCAAGTCGTTCTTGGAGGAGCA
GGGCTTCACGATGCTGCAGTCGGAGGCCTGCGTGGCTGTTAAAGTAATTGATGGGCAGTTGGTCTTCATCCCTCTCTATGTTGATGATCTGATTTTGTTT
GCTCCGTCGATGGAGCTCATCAACAAGATGAAGAAGATGTTCGAGGACCGGTTTGCGATGAAGGATCTCGGGGAGTTACACTACATTCTAGGCTGGGAGA
TCAGGCAGAACCGGGCCGAGAGAACGATGTTCATTGGTCAGCAGAAGTATGCCGAGACCGTGCTCAAGCGGTTCAACATGCAGGACTGCAATGGCTGCAA
GACGCCGAGCACGGCGGATCTGAAGCTGAGCAAGGCCATGTGTCCGACCGAAAACGATGAAAGGCAACTGATGAGATCGAAGACATACCGTGCTCTGGTT
GGCAGCCTGATGTACCTGATGCTCGGTACCCGGCCCGATCTGGCCTACCTAGTTAGAGAGTGCAGTCAGTTCTTGGAAAACCCAGGTCTGTTGCATTGGA
GAGCTGCAAAACGTGGATTGCGCTACCTGAAAGACACAGCGGACTGGGGGATCCAGCTTGGTGGCGTAGCGTGGTCAGATCAAAAGCTGGATGGTCATCT
GAGAGCATACGGATGATCGAAAGTCTGTTGCAGGCTACGTGACTCAATTTTGTGGGAGCATCATTTCGTGGAGCAGCCAGACGGAGAAGCCCGTCGCGCT
GCACACGACCGAGGCTCTTATTCTACTGATGCAGGAGGTGGTGCACTTGCGCCAAATGCTGAAGGAGCTGCAGGTGCAGCAAATTCAGCAATCCCAAGTC
TTTGTGGACAATGAAAGTACGAAGAAGCTTGCCAGCAACCCTGTATTTCACTCCCGGACCAAGCACATCGATGTGCGCCACCACTTCGTGCGTGAGCGCA
TCGATTTGAAGGAAATTGACGTGCTTCGGGTGCCAGGAGTTGATAACGTGGCCGATGCTTTTACAAAGCCATTGGCACGTCCGGCATTTGAAAAGCACAG
AGCTGCAATGGGATTATTGCCAAGGGCAAGATTTGGAGATGCAAGTTGATGGGAATCCGTAGGTGGGGCTGTTGCGGATTATACTGATCCCCACTATACC
ACTTGCAGTT