Description :
From Genome Similarity Track
Location :
Scaffold_431:6988- 9314
Transcript NameFunction/comments
Albla_Nc14130810Putative cullin putative

Sequence
2326 bases(100 bases per row)
AAAACAATGATCACGTTAGAGGAAGGATGGGATCACGAGATCAAACCAAAGGCGATTGATGTGCTACTTGATATCTTGGACAGAGGATTCGAGAATGTTC
ACGAGGGCCCTTTTCCACCAAAAGTGTTCATGCCGATCTACACAACATGCTATAATATGTGCACACAGCGCTCTCCATACAATTATTCAGAGCAGCTGTA
TAAGCTTCATGGGGAAACATTTGACGACTATCTTGAGAAGAAGGTGCTTCCCTCCTTGCAGCAAACGCATGACGAGTATTTTCTTCAACAGTTGGTGAAA
CGCTGGGAAAACCACAAGATAATGAATCAGTGGATGTACAAGTTCTTTATGTATCTGAATAGATATTATGTTAAACATCATGCCTTGCCAACGCTGGAAG
AAGCAGGCATGCAAAGTTTCTATCGCGTTATTTTCCAAAAGGTGGCAACTCGAGCAAAATCGGTCGTACTCCAATTGATCGATAAAGAAAGAAATGGGGA
ATTGATTGATACGGCAATGATAAGGAATTGCATCGAAATATACGAAGTTATGGGGATGAAATCGTTCTTGAGTGTATACCAAAATTACTTTGAAATTGAA
TTTCTGCAAAGTACTGGAATCTTTTACCTCAACAAATCGAAAAGTTGGCTCACGGATGACTCTACGCCACTTTATTTAAAAAGGGTGGAAGAAGCATTGA
CGCAAGAACGACAAAGAGTCTCAAGATATCTGAATGCTTCGACGGAACCCAAGGTTATTAGGAAGTTAGAAACAGTCTTATTAGAAGAAGCACAGAAGGA
ACTGATAGAGCGGGAAAATTCTGGAGTGATTGCTCTGATGAGTAATGATAAATTGGATGATTTATCTCGGATGTTCCGTTTGTTTTCCAGAATTGAGCAT
GGACTGGAGCCGATTGCTGACCTAGTACAGCAACATATTACAGCTGCGGGAAATGCAATCGTCTGTAAAAGGATACAAGAACTGCAGTCCGGGATGGTGA
AGGACGCCGCTTGTGATCCGGAATATATCAAGGAGATTCTCTTTATCCATGATAAATTTCGGAATCTCGTCAATGAACAGTTTGGCGGTAACAACTTATT
CCAGAAAGCTCTGAAAGACGCATTTGTAGATTTTGTCAATAAAGATGTTGGATCCGACAATTCCGCCAAACTTGTAAGTACCTTTTGTGATCGCATCTTG
AAGACGGGCGGCGAAAAATTGAGCGATGAACAAGTTGAGACTTATCTTGAAAAGGTTGTATCGGTGTTCTCATATATGATCGACAAAGACCTTTTTGCCG
AAATATATCGAAACCAGTTGGCGAAGCGATTGCTAAATCAGCGATCTGCATCTACGGACGCTGAGCTTTTGATGATTGGAAAGTTAAAGCTTCGTTGTGG
GGCTCAATTCACCAGCAAAATGGAAGGAATGATGAATGACTTGACAATTGGTACCGATCATCAGCAAGACTTTGAGTCATTTTTAAAGTCGCAATGCAAA
GGTGGGAGTGCCCAATCTGAAAATGACGATGCATTAATCAAAACCGATACTGCTGGCATCGAATTCACTGCACAAGTCTTGACGACGGGTTACTGGCCAT
CTTACAAAATTCTGGAAGTCACAATGCCACCTCCAATGGTACAGTGTATGAGCTCATTCAAAATTTATTACGATTCCAAGACGAGCCATCGCCGTCTACA
ATGGATGCATTCCCTTGGAAACGCTACGGTATAAAGCGTGTGTTTGTATATACTAACTCAATTTCTGACATGAAGCTTTGTAGGTCCGAGCATCATTTTC
TTCTGGGAAACAGTACGACTTACAAGTGACCACATTGCAGGCAGTCGCGTTGCTACTTTTCAATGATGAAGAAGGTCCTTTTCCTTTTGAAATACTTCGA
GAAGCACTCAATCTGTCCGTGGATGTTGTGAAACGAACCTTTCATTCCCTGTCATGTGGAAAATACAAAATCCTGACCAAAACTCCTCCCGGAAAAACTA
TCTCAACAAACGACCATTTCAAGCTGAACAAATCCTTTTCGTGTCCCATGCGTAAAATTCGGATCCCAATGGCTTCTTTGGAAGATAGTCATAGTCAAAA
ACATGTGGAAGACGATCGAAGTATAGCAATTGAAGCTGCGATCGTGCGTATTATGAAAGCTCGCAAATCATTACAGCATCAACAACTCATATCCGAAGTA
TTGAGTCAGCTTTCTTTCTTCCGTCCCAATTTGAAAGTTATCAAACGACGTATTGAGGCTCTCATTGATCGCGATTATTTAGAACGAGATCCAAAAGTAG
AAAACACGTATCGCTATCTTGCATAA