Description :
From Genome Similarity Track
Location :
scaffold_74:69872- 73566
Transcript NameFunction/comments
g2829.t1 phosphatidylinositol 3 and 4-kinase-like protein

Sequence
3694 bases(100 bases per row)
GCTCCATACAGCGAGCTACGCATTACAGAACTGTTAACCTTGAAGGAGCGACCGCACCTTCATGCGGTCGACGGCGTCGGAGGAAGCGAAGCCGGCCACG
TCGATCGGTCGTTGGCCGTTGCACAGCAGATCCCTACGCCAGCATACCACGACTCACGAATCTCAGCACTGCAGGCACCGGTCAGCAAGACGATCGACGC
ACGTACTTGTCGGCGCCGCGGCTCAGCAACAACCTCACAACCTTGTGGCGCCCGAAGAAGCTGGCGATGTACAGTGCTGTTCGCTGGGCATTCCACCTTC
ACTTTAGCACCCGTCGTCGAACATCATTTTCTCTAGTTGTCTCAAACCTGGTTGTTGCCCTACCAACCCAAGCAACCCGTTAAAAACTATGCGTACCGGT
ACTTCTCGCCTTGCACACTTACGAAGATCTACCCAGGTAATAAACCATCGACTTGAGTGAACATTTACCCCACACGCATGAAGCCATGGCGGCTTGACAC
AAAAGATCAACTGTTCTCTAAGCACCCACCTTGGTGAATACAGCTGCGGGGTGTTTGGCGATGAAGCGCTGCACTTGGTCCACTTGATTCTCTCGAATAG
CGCGGTAGAATCCATTAAGAGCTGATTCTGACAACGTACCCTGCTTGGATTGGTTGCTGCGACGGTATTTGCAGTTCCACCACTGCATATTGCGCCGGCA
AAGCGCTGGCGACGCAGTCATACTCGGAACCAGCGACCACGTACGTCGCGTCGTTTCGCCCTTTGAGAAAAAAGTGTAGGCTCCGTTCCACCTCGTTTTA
GTGACTGATTCTCGTGTGCGGAACGTAATCACCGCTCGATCTCGAGCCACAATCAACCGTGCAGCTGGCGGCGGTGTTTGCAGCTGGATGAAGTGCCTCC
GCGTTCAAGCAAACACGGCGACGACTGCAGTGGCAGGAACGGCACCACAGTGCCGTAATTATTCAGACTCGCATCATCTCTCGAACAATCGATTTGTTCC
ATCACGTCGATTAATCGATGAAGCCAATTCCTGGATATAGATTCTAAAAGGGTTTCAAAGGGCGAACCCAGGTTGTACATAACCTGTTTGAAACAAGCGG
TTTGGGCTGTCCAATCGGAAACCCTGGAACTTTCGATGGTTCATATTTTATCGGATTTTATCTCAAAATAAATTGTCGCAGGTGCCTACAACGAAATAGG
TTGTGGGTAGGTGTATTATATTGCTAAAAGCTAGTGTTTAGCTAAAACCACGAAATAAGTCCCCTCACTGCGGGAAGGCGAAGGCGGCGAGGGAGAAGCA
AATATTCGCCCAGCCAGCAACACCTGGCCCAGCCACACAGCGGAAGAGAGCGAGCTCTACGCCCCCCAGCAGCAGCCAGAGCTTAGTCCAGTCTCGCGCC
CGAGGACAGAAGCGCGAGTGGCCGTCTTTTAAGCAGGTGAAGCAGCGTCGGCCACGGTACGTTTGTGGAATGTTAAATACCTTAGGGGGAGACACTTATT
CTGCAAGAACGATATGGTAATGGTTTTCTTATTTTAATACTGATGTCAATAGATGTTCAGCCTGAACCCGCGGCAGTCGATGCAGTCAGTTCTGCAGTCG
AGCGGCAGTGCCGGCAGCTCGATTCGCAGTTCGACGACGTCCTTCATCTCTGCTGCCTACAATAACTACACCAATGGCACGAACTTCCGAAACGTGGACG
CGTCGCTCGTGCCTTCTTTTGAGGCTTTAAATCCTTACGCGAATGTGGGGCGTAGCATGATGGGCGACGACAAACGGTGGCAGCCGGTACCTGATCTTTT
CCACTCGAAAGAGTCGCTGTACTTCCGCTCTGCAGTGGGCAAAGTACTGAAAACAGCCCACGAGGAGATCTCCCCCGCTGAACTAGAGGTGCGGGCCAAT
ACACCCGAGTTTAAGGTGGAAGAGGGCGACTGGATTGCCCACAACTCCAACCAGAAGAACCAGTTCGCACTCATCACACCCTTGAAGACGGTTGCGAGAA
TTCCAGCCAATCTGATCATCTCCGATGAGCCGATCTCGCTCACACAGCCTATCAGCAACCACATGGGGGGATATCTACGCAAGAAAGGAGAGAAGAACAA
GGCCTTCAAGAAGCGGTACATGGAGCTCAGTGGCAGTGTGCTTGCTTACTACAAGAAAAAGCCAGAGAAGAACGGCATTCCGCTCAGCAGAGACGAGAAA
AAGACGCTGGAGAGAGGACGGATTGACTTGGATCGAGTGTCTTCATTGCAGCCTATGGAGTCCAGGTCCGAACCGTACGGTATTCTGCTGGTTACGACCA
CCCGTACATGGGCTATCTGTGCTGATTCGGAGCCTGAGTACCAGCGCTGGCTGAAGGCGCTCTGCGATGTGGTCAAGTTTAGTGCTGTTCACGTGACGTA
CAAGCGGATGTTCCAATTGCAGGAAGTGAGTGCGAAGGCCATTACGGATGTCCGAATGGTTGTCACGACGGGCGATACGGTCGGGCAGATTGTGGAGCAC
ATTTTCAACTGTTACGAACAGGCTCTGGATGCAGCGCCATTGAGACCTTACAATCCGGCGGAGTATCGCCTCAAGATTACGGGGTACCGTGACTACATGA
TCGATAGATTCCGTGTGCTGAACGAGTATGTACACGTTCGCGAGTGTTTGCTGACCAAGAAGACCATTCGTTTGACGGTGATTCATGAGTCGGTGATCCA
AGAGACAGCTATGATGAACCTCAGCATCGGCAGAGATCTCCCTGTTAGTACTGGATCGATGAACAACATCGTCAACCAGTTTGCTGATATGTTCGATGGT
GAGCGAGCAACTTCGTTGCAGATGACAACACTTGGAGACGAGTGGGAGCGCCCTTCAGTGGACCGCAACACGTCATTGCCAAGTGGAGTCATTCAACAGC
CGTTTGCAATTCGCATTCGCCGTGTGTTGAACATTCCGCGAACTACGTGTGTGAGGAAGAGATCTAGTGAAGAAGCCATCGTGACCCGCATCCCTTTGAC
GAGCTCGAGTGTGATTGTTCGCATTGAGCTATACGATGGAGGCCAACTGCTGGAAAATGCTGTTATCGATACGTCCGATGTACGCTTGAAGGCTCAAAGG
AATGATTTGCTTTACGCGGAGTGGGAAGACCCTGTGTGGCACAAGTTCAATATCGACATTAGCAACTTGACGCGTACCATGCGCGTTCAGTTGACGGTTT
TAGGTGTGAAGAAGGTTGTTGGTGCGTCTGCTTCAAGTATGGACGCTACAGAAGAGAAGATGCTGGTGACGGGAGTGAACGCCTTTGAGGTCGATGATAT
GCTCGTTCAAGGACAGCAATATGTGCACATGTACAACAACTTGCACTCCTGCAGTCAGGGACCAGTGCCTCACGTAACGCTGCCCAATGAGCCCATGATC
CAGATGGAATTATCCAAATTCGATGCACCAATCAAGTTCGACTGGGATGACAATGATAGCTCGTCAGTGAGTGACCGCTCTCACCGTCGCAGCATCATCA
CGAGCAGTCGGTCGGTGATGCTACGGAAGGAAGGATGGCTTCAGAAAGTGGGCAACTTTTCGTCTTTGACTCGCTGGCGCCGCCGTTGGTTTGTTGTTGA
CCAAAGCACTTGCACACTCAGCTACGCTGACGACGAGACCGCTCCTCGTAAGCTGATCACTCTCCGCAACTGCTCTGTGACGACTGCAGATGAT