Description :
From Genome Similarity Track
Location :
Scaffold_193:69851- 72877
Sequence
3026 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCCAGATCTTGCTCGAGGTTGTGGA
TCCGGGATTGGAGTTGGTGGATCTCAAATCCGGCGAGTGCCATCTCCCTAAGGAGATGGTCGTTGTCATCTCGCATAACGTCTCGTTGACGGGAGGCGCG
ATCCAGCCGTCCGATCAGGTCGCGGATCTCGACCGCCTGATCAGCCAACAGGAGTCGCAGGTCCTGCGACCGAGAGGCCGCACGGTGCTCCCACCCCTGG
ATCTCCATAGCCTGGTCATGGACTTGGGCCCGCAAGGTCTGAAGTTGGGTAGTGTGTAGAGACGCAGCTTGGTCTTGGGCATCTTGAGCCGTCTGGAGCT
CCGCCGTCAAGGTTTGCACCTGATCGGAAAGAGCCTGGGCCAGAACCGGCAGATCGGTGGGCGACATTGAAGACGGACTGACCGGAGGGGTGGCGGATGG
GGCCTTGCCCGGCGATTTGCCAGTACGTTTGGCGGGAGACATGTGTCACGAAGAGGATAAAGCGGTTGTGGATGTTGGTAGTGCACGTCGTGGACGCTGT
TGTGCAGCGCCGACCACGTACAGGAGGCGATTGTGGTGAAGTGCTTTCTCAGAAACAAGAGAACGGGCCTGACGCGGGGTCACTATCCCGAATCAGTGAC
AATTTCAAGTGATTAGAGAGGATTTGGGTTGTTCGGCACGGGTGCAGTTGCCTGTGGTGGATTAGCCATGACGAGCGGCACCCCGTAGGAAATGACGATG
GATCTGGTATGAGCGATGTACGAGAAGGCAAGATCCACCAAGACTCATCTCGGATCCACCCTTACCTGGATTCACTTAAATGGATATGGGATATACTATA
CAAGAGTGGATCGGGTGTGGATCTTATGAAGGAATGGTGATAGGTGCCATCCAAAGGTGGATCTAGTAGCCACGGCTAATGAGGAGTCAGGATCCACCGC
GAGGTACCCCGGATCCCATACTTCCGAGTTCGGATCCATGGAGGGAGGATCCCGCCTTGAGGGACCTGGATCCAGGGTATAGGGACGATGGATGCAGTGG
ATCTCGAACTTTCGTGGGACAATGGGGATCACAGATGGTGGCGAGATGAGGTTGGAAGATTGGAGAGCTCAGATCCACGACGAGTGTACACTTGCAGTGA
AGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATAGGGTGACCGTAATGATTACGCCATGGATCCGGTGGATATGAAGATAATACAGCTGG
GATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATAGAAGGTAGAAATCCAGGCAGATATAGGCTTA
AATATCAATACAGAACTCAATTTGCACAGTATCACGCAAGTGCCTTCCTGCCCTCAAGAACTGGAACTACATTTGGCCGTACGAGCTCGGAGAAGGTTGG
GAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTTTGCTTGTGCGGATCCGACAGGTT
AACCGAATTTACTACTTGGTCGGTTACACCCTAGGGGCTCTCAATTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACAACGCAAAGGAACGCAAAGGCA
AGGGACACACCCGCAAGGCAACCTTTCGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACAATCCACGGAC
GCAGAGTGAAGACTTGCCACTGCTGATCCACCCCATCCCCACGTCTCGCCAGGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGC
AAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTG
GTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACACAGGTGTAATATCGATACATTGAATTCCATAATCGTTGATTAAGTAAGC
CACTACCTTGCTCTGGATTTAACCCTCCGTCTAGACCCATCTGCACCACCTCTGTTTGAAAGCTTTCCCAATCCATTTGGAGCGGGGATTGAAACATCGG
GACTCCGCCAACTATGATTTGCAGGCCGGTGAGCGCTGCGAATGGTCCCGTCCCTGACGGTTCATGCGTCGTCACAGAAACCTCAGGAGCGCTTGACAAA
TTGACCAGAGTACCTGAGCCAGCTGTTGCTCCGTTGCCTGCATCGCCGATCAGCATCGGAATGAGTCACTCTCTTGGGGATGACGATGCCTGGCGAGATT
GTGCCTGAGAACGATTGCAATCGATCGATGTAGAAGCTGGTGACGAACCGCTCGAGATAGCGAATCGACTTGGTCTGAGTCAAAGCTCTGTCTACGTCCG
CTGAGGCCACATAGTACGGCACGTAG