Description :
From Genome Similarity Track
Location :
Scaffold_433:6985- 11055
Transcript NameFunction/comments
Hyaar_Emoy2814120hypothetical protein

Sequence
4070 bases(100 bases per row)
ATGGTCCATGCTGGGAGTCTCCATACTATAGCACTACAACTCCACCTCCTTGCTTAGTACGGGCTGACCTATAAAACTCATTTACGTACAGCTCTTCGCT
GGATCCTCGGTGGGGTAGGCAGGTCGATCGTCGGCATTGCCTGCTTTGTAGGGGCAATAGTCGACAGTATTGAGTCTACACTCTCTCGAAGGGTAATACT
GGCTGCCAACGCCCCCCCTCGCACCTGCTCTTCACTTTTTTACACAGCTCACGAACTCCAAGGTCCACTGAGAGCGGCTCAATTTCCCAAGCGCCCCTTC
AAATTGGCAGATTTTACTAATTTTGCTAATCGAATGTCATTTCAAGAACTCGAGGGGTTGGATGACCAACATGATGACACAGGTCTCCATTATGCGTAAC
AAGGCTAATACTTCTTTCTCCTCAGTACTGCCATATATTTGATTAGCCTTGAGGGTAATCTTATAAAAGTCACCGGCATAAGTAGTACTTCGTAATCCTG
TACTTGTGACACCCAAATGTTCCATTCACTTGCATAGAAAATAATGACGGCTTGTCTGGTCGAGTTGAAGTGTCTCAGAATTGGTGCCGTGGCAATTTAT
TCTTGAGTATAGCGAAGGCTACTTGAACACGGGTCCACCTTTCTTCGTTTTCGTCTTGGGTGGTGGTATTTTTATCCCGCTTAAACTGGCTTCGCCCCGT
ATGGAAATCCATCTCCTATATAATTCGTAGAGAATAGACGCATACACGGCGTAGTCTTCAATATAGGTGCGATGATAAATTAACCTTCCCAAAAAAGATT
ACATGGCCTTCAGTGTCATTGGCAAGCGTAGGTCGAACCGAGATTGAATGCTCTTCGAATGTGCCTCCAGTCCTCCACTAAACACTCGAAGCCCAAGGTA
GTCGACCTTCCGGCATCCCCACGAACTCTTCACTGCGGTGATCGACAAATTCTAGTAGTCGCACACATCCAACACACATTTCATCTTTGTGCACAACGCA
TCCCATGATTTGGCGGAGATCAGAATGTCATCTTTATATGACCGTCGACCCAGGATCGAGGAACTCGACTGCGCGTCTGGCTCTCCCACCTCGAACAAAT
GCTCCGACCTGTTTGTCTCTACGCTTTAGGAAATTCGTAAAAACCATATAGAGCATTATCCAAGAGTGGCTGGTATATTTGGGGCGCGTCCTTGAGCCCA
AATAGAATCCGCATCCATTCAAACAAACCCAGTGGGATAATGAACGCTGAAATTAGTCTCGCCCTTTCAGTCATACGAACTACCCGATAACCACCCGCCA
TGTCCAGCGAGCAATACCATAATGGCTTGTACAGGTCTTCACATAGTACATTAATCAGAGGCATAGGATAGACCATAAGTTCAGTCAGGTCATTCACCAA
CCTGTAGTCGATGCACGGCCTAATGTCTACCCCATTTTTCGTCACAACAAAAACGATTGGGCTAGCCCAGGGCGAGTTAGAAGATTGTATAATATTCTTA
GATGACAGCCCCTTGATCAGGTCGGCAAACCTCTCCTTCAATTAGGGGGCTACTTTCCGTACGCGTTGCGCGATCGGATTTGAATTTCCTACGTCGATGT
CACATATAGCCCTTTGGGTGACCGGCGGTAAGGCATTCTTTTTCTCCATCAACAGATGTCGTCTCTTCCAGATAATCTGCCGAATCCGATCCACCTCGTC
TGGAGTGGTTTCATTCGGATCAGGAATCTGTATATGTTTTAACCCGATAGTTTCAGAGGAGGGGCCCACTTTCGATATGGTTGCCCATCCTCGGTTTATT
TCTTCGGCCAAAGGTCTCCACTTTTTAGCGTGCACACTTGTTCATCGTCATGTAGTAATTCTCTGACCTTGGTTTCCACTTCATCGACTGCGATCTCGAC
CGATGGATCGGCTTTGGGACCACTTCTTTCTTGAGGGATTTCTTCTTGTAGAGGCACCACTTCAATGCGATGTGGTCTTATACTGTGGGGTTTCCACCAG
TGGTGCCTCGGCTCCCTTCTCAAGCTCAGCTTGAGGGTCAATTTTATCGGGTGGATTCATACGCCAGATTCATCCACTCAGCGTACCTTTTAAAGACCAC
CACGACGAATCCTTGTGTTCTTGGTACTTTATCCTTCGTCTGTCACATTTCCTATCTTGGTATCGTCATGTAATAGCAACGTGTGGGATCTGACGTTTGT
CACGTTCAACAATTATCGGTATCCTATCCCCTGGGTCATAATGTAACCCATTGCTATCCACTTGTGACCAAAATTCTCGATTGTTCTGAGGTCCACCCAC
CTACCTGCAAGTATACAGGCATATTGTCCCACCTTCACGTGTAATACTAGCTTATAGTAGACGGTCCCTCGTCCGGAAAATCGTATCCGGACTTCGTCAG
CGAGGCAGAGTGTTCCATTCGTCAAGTCTAGCCGGATACCAGCCGGGACCATGAAGTTCATCCCTAATATCGATCCCTGACCCACTATAGGGCCTACCCA
CGCCTTAATATCGTACACTAAATTGCCATTTAGGGTGACTTCGGCCTGAGTGCACCCTTCCGTAGAGTATACCGATTCCCCAATACCTATACACTCTTGT
CTTCGCTTTCGTCAATTTGGCAGCCTACCTAATGAGCAAAAGTGACATCTAAAATAGATATCTTAGCGCCAGTATCGAACAACAAATTTGCGCGACCTTT
CTTGATCTGTCCAGAGCGTTTGGCTTGTTTAAACTGCTTAGTGGGTGCATGGTATTTCCAGTATCCAATGGGTCTCCAGGCAGTAGTTCCAACTCCATCA
CTGCATTTTCTTGGGCAAAATCATTAATTTCATTGAGACAGGACAACATGTACCACAGGGCATTTTCCAAGCTTCGATATATTATCGGTCTTCTCAGTAA
AAAACCCTCTCTCCTCCTTGGGCTGCTTTTCCGCATTTGCGAAGATACAAAAACTAAAGCGTTCGACTCTTAACAGATTCAAACCTGGCGAGCGTTCTAA
TTCATATCTTCTCAGTTACTCCGGCAACATTCCGGCGTACTTAATGGGGATGTACCATTGACGATTCGAATTGTGGAAGTCCTCTAGATGGCACTACCCC
GCTTCGTGGGTCTCTCCGCATCCTTGGCACACTAACAAACAGCGATCTGATGGGTGCCCGTTCTTCCCACTGCGGTTGCAGGACATTCTCTTCCAGCATC
TCAAATCTCCATGTTTCCTGATATGCTGTGGGCACATCTCAAATTTGACTCGGCCGACGTATTGCGGGTTCCTCGGTCTTCTGCTTGTTTGCGATGCTGG
TCGAACTCTCTGGTGGGTCGTTCCTTAATGGTTCTTGTATTTTGGTATCTTTCTGCTTCCTCTGGATAGACCTGCCTCAGGTCTTCCTCGTTATCCGGAT
TATCCAAGCTGGACCCCTTCGAGCTCAACTCTTCCGGAAGCGCTCGGACCGCATGTACAGAACGGCGGTTGATACCTCTACGTCGACCAGGAGGGACGAG
CACCTTTTGTCGGCACTTTCTCGAGCCAAACCGTGTGTTGCCACGCGGCTCCTTCGTTCTCAAACGCGCCTTCAACACTTCCTCCAGTTCTTCCACATAT
GCCAGACGTAGCATCGTCAATTGGTCAGCCAACTCTGGGTCGTCCACGGTCTCGATGTAATTCTCTACATGTTCCTTCTGAATTTTAAACGATCCACATT
TATTTCCAATGCCCTAAGAGCTATCACATTCATGCGGCACAGATAGTCCAACTGGGATTCACCTGACCTCTTCTTCGCGTGGTAGTACCGGTGAGCAACT
GGTATCCCCAGTCCACAGAACTGCATCTGGAATTTGTGTAGCAGGTCTTTCTAAAATCTCCGAACGGAGCGACCCAGTTGACGATACCAGGTCTGAGCTG
GTCAGGTCAACAGTTCTGCGAAGACAAGACACCTTTCGCTGTCCGGTGCTTGGTACCTTGGGAAGGACGTCTTCAACGTGGTCCTCCACTTGCGTGCTCG
GTCCTCGTCCAGATCTCGACCACTGAACCCTTTGAGATCCGAAGTTGCTGAGATCTTGGTGCGGGGACCA