Description :
From Genome Similarity Track
Location :
Scaffold_113:69841- 71837
Transcript NameFunction/comments
Aphas_H257_17480Hypothetical protein
Aphas_H257_17481predicted protein

Sequence
1996 bases(100 bases per row)
GTGCTGCTCGTGTACAATGTACGACATGCATGCACCATGTCTGATCATCACGACATGTCTTGGAGCGACAGGAACAATTGCTCGAGTACGAAGACAGCGT
TCGATGGGAAGCTCTGGCCACGTCATCGACAGATGCCTTTATCAAGCAATTCCAAGCCACGACACCACCCCCACCACCCGATGTGACGCTTACGTGGGCG
TCCCCGGCTCAAGCGTTGCACCTACACGAGCAGAGTGGCATCTCGTCGTCGACGCCCGTGCCGCCACGTGGAGTGCATCCCCATCCCGTGATTGTGCACC
AAGTGCTAAGCGAAACGTCATCTCGATCCGTGCATCACATTGAGCTCGACATTGCACCTCAAACTACGTACGACACGGCTGGCAACTGCAATGTGCACTT
GCCAAATGCAAACTCGGTCGTCACCCGGTGTTTGAAAAGGCTGTCGAATCGCCCCACGACCACCAGTTTGGTCCAAGTCCTTCCTGGCCACTCCAAAACA
TACTTACCCTCGAACGAATGGCTGTCGCTGACGTCGCTTTTCACGTGGTACGTTGACTTATCATCCACGCCAACCCCCCGCCTCCTTCGACACTTGAGTG
GGTACGCCACCGCCGCGCCCGACCAGACAAAGTTGGCGCAATGGGCCACAGACATACCTCGAACTTTGTCCTTGGTCGATGTGCTCGAAGCGTGTCCGTC
TGTCGCGCTCTCTGTGGAAGCCTTACTCAGTCTCGCGCCGCCACTCGTCGTCCGCAGCTACACGATTGCATCGTCGCCCAAGACCAACCACACGTCCGTC
GCGCTGACCGTCGCGGCCAAGCCGCCTCCTCTGGACGGACGCTGCTCGACCCACTTGGCGTCCACGACGCCGTTTAGTAGCACCGTCTTTGCGTCGCTGG
CCCCTTCAGCCTTTAGCCAGCACTGGGGCGCGCATTATCCACCGACAGTGTCACTGCTGTGGATAGGCGCGGGCACGGGCGTCGCGCCCTTTCGCGGCCT
CATCCAAGAGCTGGCCCTCGTAAAGAACCGACCGAAAGTGGCGCTGTACGTGGGCTGCCGGGAACCAAGTTCGGACGAGTTGTACCAGTGTGAAATGCAA
ACTGCACTTGCAACACAAGTCCTGTCGGCTTACGTTCCCGTGTACTCCAACCACCCTCCGACCTCCCACGTACGTCATCTCAGTGTAATCTCATCCCGAC
GCTGTATATTCATGTACTCAACCATAGACTCAAGATGGCCCTTGGCATGTCGGGGCCAAACTCAAACAAGACGCTGCGACAGTGTGCCAGTACCTCGAGC
ATGGGACAGTGTATGTATGTGGGTCGCTGGCTATGGGTCGAGATGTCAAACTGGCGCTGGTGAATTGCTTGGAGAGCCATCGCGGATGGTCAGTCGACCA
AGCCAAGGCATATGTGACATCGCTTCAACTCAACGGGCGGTATGTGGCCGAAGTGTGGTGACCACAGTTTCGTAGTAAGTAGTACTAGTAATACTAGATT
AAACCACCAAACTGGTAATCCCATCGACGACGCGTGGCTCGCAGAGATCTTCGTTGTTTTGGCTCGAAACGCTAGATTAAGCAAGCAAGTAGCGAGTAGT
CGGGTCTTCTTGGCGATGTCGAAGCTCCCGCATCATGACCACGGTCATGGATACACACCCACTAAACATGACGGCCGACGCCACCCAATGCAGTCCGTGC
GGCTTCCACCGCCGGTCCGTGGGCACCGCCGACATGGAAGTCGTCGGCACGGCACACGGCCGCCACTCGCGGGCGAACGCAAACGTGTCGTTGAAGACCG
TCCACTCACACAAGTCTACTTGGCCGTTTTCAACGTCATCTGCGACAAAGTACGACACGTACAATCCGAGCAGAACGGAAGCAAGAGCGGCTGGCCGTTG
TAGACTGCGCGCACCGCATATGCCGCCGATGCGTCGTTGGTCGGATGTTTGCTTTCCTAAGCAATGGTAGTTGGTGTATATAGATAGTACTGTATT