Description :
From Genome Similarity Track
Location :
Scaffold_66:69811- 77786
Transcript NameFunction/comments
Phyin_T30-4PITG_18201Avirulence-associated protein 3.4%2C putative

Sequence
7975 bases(100 bases per row)
TAACGTGCACTTTAATCTCGACATGAATATGAATGAATCCAATGCTGACCAGGTGCTAGTAACACCGGCACCCGCAGATTCATGCAACAACATGAGAGGT
GTTAGCACCAAAACGCTGAAAAACTATAAACTTTTGCTGAACTTTTTTTGTTGTCACTGGGATGAGACGATCAATGTACTGCAAAGTATGATTGAAAAGC
AATTTGTAGAGGGGTGCTCTGTGTTTACCAAGTGACCAAGTGCACTAAATTCAGTGTTGCAGTGATTTTAAGACTTCCAAACTTCACACACTCTATGGTA
AGGAAGCAAATACTGCATCACACCATCAGCGCTCCACAAATCGCAGTCATGAGCTATTGTTCGGCTTTCAAGTTCGAAGAAGCAAAACGTGACGTGGAAA
ATCGACTCGAATTGCTATTCAGCTGCAAGAAAACGTTCTCTGAATCAGCGTAGAGCTTGTACAAACCACGTTTCATTCTGTTGAGTAAAAAGGTACCACA
ATGTCAACTCAAATAAGGCAAATACACGAAGAAATACAACTTGATCTTTGGTAGAACCACTCAATCCGACCCAAAGCACAGCGCGTTTAAAACTCCTCGA
GCCCCACGGCTGTCTCGCAATCGACAGTGTAGCAGTAATCGGAGCATCACGCCACACTTGAATACCATGTGAGTGCCCCGTCGTACTCCATAGCAACGAT
CCGTCGGCTTCATCTTTGCCATTCAACGCATTGAATCGCCTCCAGTTTACCGATCCTGCAAACCCGTACCGACAAGAAACCTGCTGTCCCGCATTAGCCA
CAACGTTAGACGCCACTCCTGTCCCGACAGCCACAAGAGCCACAAAGAGCCACCTAGCGCAGAGCAAATACCCACCTTCTGGTTCCTCAAGTTGGTGTAA
GCACAGACGACGTGTATACCTATCTCTCGCATTCGGAGCCCCGCGTGAGCATCCTGCAAACCCGTGTCGACAAGAAATCTGCTGTTCCGCATTATCCACA
ACATGATACCCCACTCCTGTCACGACAGCCACAAGAGCCACAAAGAGCCAAATAGCGCAGAACGAATACCTACCCTCTGGTGCCTCAAGACGGCGTAAAC
GCAGACGAGTGTATACTTATCTCTCGCATTCGAAGCCCCGCGTGAACAAGCTGACATATGCGCATCAACGGGGTTTTTTCGCAGCTCGAAAAACACCCAG
CTCATTGAACCCATGCGCTTCAACAACAGCAGCCAGTACCCTCGATCGACCCCCAAACGGTGCTCTGGGGTCACCACTGGCCGGGGCCGCGGGATCCAGC
TTGCCCGGCGTGTAGCTGCACATACTTCCCACCCCTTCGCCATTTTCCAAATGCTAAATCTCCGAAGGAGTAAAAATATGCACCAAATTAGACCTCAAAA
CCGCCGAACAGATCTTTTCGTACCATATCTCCCACCACTAAGCCCCAGATCCAGTGCAAACGTAGCCAGCGACCCCTTCTCTCCATGCACTTAGCAATGC
GTTGAGCCGGCGTAGACATTGCGCGGACCTCCACATCGTACGTGGAGGCCGTGCCCGCAGTGTTAACGGCCATTTTCAGTCTCGCAACGAGTCAACAATC
GTTGATGCTATGGTCGACATGGTCGATCCGGTCGACCATCCATGCAAAGTCATACTCTACAGTAAAAGCATCACACCACCTTTCAACTACGCACACCTCC
AGCGCACCATCACCACGTTCACATGCCATGGAGCGCATGTGGATACCACAATCGGGTCATCTTCACTATGGACAATAATGGTTATTATGTTCCAGCTGGC
CTCGCAACACCCTCTGCGGTGATTATCCACGGTGATGCCGGCTTGACGGAGCCGCTATCCGCTGGTTCAATGGTCGAGGCCATCGTTCATGGTCATGCAG
CGGGCCAGTTGTAGACATTGTAGGCATTAACGCTCCTCGGCCTGTGCAACATGGCACGGTTGCACTGTAGAAAATGACGTCAAAGTGGCCGTAGCGCGCC
CAGTAGGCCGGTTCGGGTGGTGAATGGTATGTGGTGGGGTACTTCGCTACTCGGCACGAGCTAGTAACGTAGAGTTTTGCCTGATTTCCGTCTCTGGCCG
CGAAAAATGCCGCCAATCCAGCGGTGGAGACGTTGTTGCATGGCAGGAAAAGTATCCTTCAAGGCCATGGCACCGTATTATCTTTGGCAGTGCAGATAGA
CGGCGTTAGTGTGCTTTTCACTCGCATTTGTGTGTATTTCATCGCATAGGGCGTGAAGGTGCTCACCTCACGTCGCCGCGTTACGGACAGGACTCGCGTC
GAGTCTCTCCACCGTTAGTTCGTGCTCCGTTTCACGATGGTCCGTAGGTAGCTCCTGTTCAGTCACGGCGAACCCAAATCGACTGTAAGTAGCAAGTTGA
GAGCGTACTGTACGTGGAATCGGCAGTGTGTCACTGGGCATAGCAGGTCGAAAGTGGTGGACATGTGTTCTTTTTTCCCTCACCTGTCTACAAACGGTAG
CGCCGATTCGCAGACGTGAAGTGAGGAGGGCGGCGCCTTTGACGTCGTTAGTGGTACTGTAGAAGCCTAGACAGTGTCAAGCAGCTTGCACTCTAAGCGG
TCGTAAGGCGAACTGACAGTCCACGAGAGTCGGTGGTATGGCTCTTGGCTTTTTGACTGGTTCTCTCCCACCGAGGCTTGTACCACGTCGCAGTTTTAAG
AAATATGCGGGGAAATAATCTTTTGGCAGATAGCCTTACAAACTTCAAATTCAAATACGAGATCCGACAGCTTTATCTCATTTCCTAGGTGGCCACATGT
CGGGCAACAACGCTGTTATTGACGCTGGATCGCAATCCTACCATCACCTATTCACTCGAAGAAAGCGTATGCAACTGAGGACGCCAAGCTGAAGAGTGAA
GCCGATGCCCGAGCGAGGTCTACGCTGAGTAAACAGGACTCGTCACGTGACCCTAGTAACAGTGAAAGAACAGCAAATACCGACTTGAGCGCTCTGCCTG
CTTTTCATGGAGCTAAAGCCTATGCTGCTTACATCGAGAGCAAGTTATCGTCTCGTGTTGCTGCAGCTAAGGACAAGGAGGAATACCTCGGCGTTACCCG
TCTTGCAAGTGATGATCAGAGCATTGAAGGTCTCCCCAAGGCAACACCTCCTTCCCGAGATGATGGCAAGGCACAAACTGGAGTCTTCGCTACGGCCTTG
TTACACTTAAGTGTGGAGGATATCGCAAACTCAAAGGAAGCGTACACAATTGAGGACGCCAAGCTGAAGAGTGAAGCCGATGCCCGAGTGAGGTCTACGC
TGAGTAAACAGGACTCGACACGTGCTGTATTGAACCAGATGCGAACTGAACTTCAAGAGCTACAGGCACAAGACGCAGCGTTACCACCTCAAAGTCGCGT
CGACTCGGAGGAGTGGGAGATTGATCTGGACTATGGAGATCTGTTGACTCGACAGGGCGATGAGGCGTGCGATGAAGTGCGCAAGGAGCTTGCGTTTGCA
GTGGAGAAAGAGGAGCTTCTACTGCTTAAGATGCGAGAGACGTACGTTGGTCCGCTCGCTGTAGAGCTGCTGACGTTGCGTGCGTTTGAAAGTGGATTAA
GTGTCCAGTCCTTCCGCATCATGAAGATGCCGGCAGCTTTACAGAAACGACTCGCAGAGATCCACACTGCAGACGCTGCTGCCAAGAAGCAGCCATCTAC
TGGAGCGAAGACTGGTCCACCTAGACGAGCGTCGGTATTAGATATCATGGAGAAGGACACTGCGCTGGACGAGGACTTTCCCTTAAAAGAAGACGAGCGA
CGTAAGCTCATGAGTCATAACGATCCTGCTGTCGGTGGGAATTGCGCAGCATCAAGCGGTCCGACAGCAGTACAGGAGACTAGTGGGTCAAAGTCCGTTC
ACGGCTTCGAGGCGCGCAAACGACTGCGCACGGAGCGAAAGGAGAGACTGGCACGCTGGCAGAGCAACAAACCAGGCGAAGATGCCGACGATCCCAGAGA
CGTGGTCGCGATCGCCTTTGCTCAACGCAACATGGGCGATTACAAGCTGAAAACGGCTCCAGACTACGTGGTTCCAGAACATCAGCGTGTCAACGCAGCG
AAGAAATTGAGGCAGATGGCGCTCTTGGAGGAGAGTCTGTATGCCGCACGCTTGCGATTCAACGCCAAAGTGCTGGAGCTTCGCGAGTTGAAGGTGCAGC
TGATCAACGAGCTGCATCGCGACCAGGAACGACTAGTCGAGCTTCGAGCCGCATTAGCGTCCAGCGGCGCAACACCATCCAGCGTGTCGTCCAAAGATCT
AGTTGTGGACCTTCGCGAGTGGCCGGAGCAGCGGGAGCGCGTAAGCGACGCCGACATTGAGCTCTTCCTTCGAGAGCAGAAGGTGATATCACACGTGCAG
ACTCAGACTGGCGAAGCGGACTTGGCATTGACGCGCATCGGTGGGGCTGAGAAGCGTCTGCAATCAGCAGATCGATCCATCGCTGCCGTCGCACGAGCTC
TGGAAGGAACGTCGGGAAAGGAGGCTGCAAAGGGCGTCACCATTGGCCATTTACATCTGCAGATGGACGACGGTACGGCAGCTGCTGCGACGGCTTCGTC
TGCACACGCGGGTGCTCTAAATGTAGAAAACATGGACGAGGATGACGTGGTTGTCCATGAATACTTGATGCGCCAAGAAGCGCTACTGCTCGAGCGCAAG
CAGCAACGCGAGATAGCGTCGTTTGACGCTGCTGTGGCTCACCTCCGTCATGAGAAACTCGCTCTCGAGGTCGGCTTCAAGCAAGCGGAACTTCGGCTGT
TCACTCTCCTTAGCGAGTTGTCGCTGCTTGAGTCGTTCGAGAGCAAGGAAAACCTGTTGAGCAGTAAACTCGAGAAGAGTAAAGGGGAAAAGGCGCAGAT
TGTGGCGGACCTGCGCGATGTCCAAGACCTGCTGACGATCAAGAAACGCGATCTGGATGAATGGGCGCGACAGGAGAAGGCTGTGCAAGCAGAGTTCCTG
ACGCTTGTGAACGGCGGCACGGGGTCAAGTGCGACACCTCACCCGAGCTTTGCGGCGCTGCAGAAGCTGTTTAAGCGCAAGATCAAGCGAGCTAAGAAGA
AACCCGCTTCAGGTGGCAAGGAAGAAGGGAAAGAGCCTGACAGTGCGAGAGACGGCGAGGAGCTAGAAGACGACGATGAAGAAGAAGAGGACGAAGACGA
AGACTATGACGAAGATGACGACGACGATGACGAAGAAGAAGATGATACATGTCCGTCGGGATGCGACTTGACTCTGTACGAGAAGGTGCTGGCCCTGCGT
GAGAAGCGTGCCGATGTAGACGACGCCATGGGGGAGCTGAACAAGGCGATCGAAGAGCTTCGGAAGGCCGGAGAGCGTCAGACAGCCAAGCAACGTGCGA
TTGACACGGAGTTGGCTGCGACGGAGCAGGATACGCAGCACTTCCAGAGTGAAAAGCAGTCGCGCTTCAACCAGCTTGACGTCGTAGTGCCGCTCAGTAC
GCGGCAACTATGTTGTCTTGAAGCTCCGTCTCCGACTCGGCAAAACTGGACGCTACCTGCTCAAGCTGCTGACTGCCTCGTGTTCACCACTCGCGCCTTC
TCTGCGTTGTCCGAGCGTATCGAGTCGCTGCAAGCAGAGAACAAGAAGCTGCGTCAGCAGTTCCGAGACCTCCACAAGCAGCAGAACGTGCTTGCTAAGG
AGAAGCGTCAACAGCAAGAAGCCATTGCAAGAGCTCAGGACCGCAGCGAGCAGCTCATGCGACTGAAATTCGGACAGCTAGTGGACCTGGAGGTGCTGGA
TCGCGCTTGTGACGCGTCTTCGGTCGACGAGCTGCAGACTCGCGTCAAGTTACGCGAGGTCGAAGGTGAGCGAGCTCTGCGTCGTGCCAAGCAGACGCAC
CCGCAGCTGCAACACGCTATTCTGCAGGCGACCGAGCAGAACACGGCCTTGTTAGCTCAGATCGCTGCACTCACGGAGCGTCAGGCCGAACTGGAACGCG
AACTCAATCGTCATCAGGGTGGTGGCAGTAGCAGTGGGGACAGTGGCGGTGTACTCAGTCTTGACGAAGACGAGGCCTTGGTTGAGCGCGAGATGAAGGA
GCGCAACAAGCTCGTGCGGCTGGTGAAGCTGCAGGCCAGAGAAGTTGAAGCGCTCAAGCAGGAGATCGGACTGCTGCGCGGCAAAGATGGAAAAGTGTAT
GCGCCTCGAGGGTAGAGCTTGGCGACGAGTAGGATCCAGAGCGGTTAATACAGAGTCTTGCTCGATAGAGTGGGAATGTGCTGATGGAGGCTAATGGTTA
TCTTGAGTGCAGCGCTTGAGGTGGCGAGGTCGCTTGTGTGGTGGAAATCAAAACCGAAAGTGAATCGTTCGAGCAGGAAGACAAGACGCAGTCGAAGTCA
AAGGTTTGTGGTAAAGAGATCGAGTGGAGAGGTGCTTGTGCGTTGGAGCTCAAAACCGACAACGACCTTCGGTTTTGAGCTGCAACGCACCCACTCGCTG
TAGCCACTGCGATCACTTCTGACCTGCTTGACTTCAGAGTGATAAGAACGCACGTAAACTTCAGCATATGCAATAGATTCGAGTCTCTTGTCTTGAAACT
GGAGGTTGCAGATCTCATTGCCATCACACCTGTGCTTGTAGTGGAGTGGCGCTACATTACAAGTCCGTACAATGCTGATCTTGCGATGGGCAGCATTATA
CTCTGAAAATTTGCTCCGATACTAACGTGCACTTGAATCTCGACATGAATATGAATCAATCCAATGCTGACCAGGTGCTAGTAACACCGGCACCCGCAGA
TTCATGCAACAACAATGAGAGGTGTTAGCACCAAAACGCTGAAAAACTATAAACTTTTGTTGAGCTTTTTTGTTGTCACTGGGATGAGACGATCAATGTA
CTGCAAAGTATGATTGAGAAGCAATTTGTAGACGAGTGACCTGTGTTTACCAAGTGACCAAGTGCACTAAATTTAGTGTTGCAGTGATTTTAAGACTTCC
AAACTTCACACACTCTATGGTAAGGAAGCAAATACTGCATCACACCATCAGCGCTCCACAAATCGCAGTCATGAGCTATTGTTCGGCTTTCAAGTTCGAA
GAAGCAAAACGTGACGTGGAAAATCGACTCGAATTGCTATTCAGCTGCAAGAAAACGTTCTCTGAATCAGCGTAGAGCTTGTACAAACCACGTTTCATTC
TGTTGAGTAAAAAGGTACCACAATGTCAACTCAAATAAGGCAAATACACGAAGAAATACAACTTGATCTTTGGTAGAACCACTCAATCCGACCCAAAGCA
CAGCGCGTTTAAAACTCCTCGAGCCCCACGGCTGTCTCGCAATCGACAGTGTAGCAGTAATCGGAGCATCACGCCACACTTGAATACCATGTGAGTGCCC
CGTCGTACTCCATAGCAACGATCCGTCGGCTTCATCTTTGCCATTCAACGCATTGAATCGCCTCCAGTTTACCGATCCTGCAAACCCGTACCGACAAGAA
ACCTGCTGTCCCGCATTAGCCACAACGTTAGACGCCACTCCTGTCCCGACAGCCACAAGAGCCATAAAGAGCCACCTAGCGCAGAGCAAATACCCACCTT
CTGGTTCCTCAAGTTGGTGTAAGCGCAGACGACGTGTATACCTATCTCTCGCATTCGGAGCCCCGCGTGAGCATCCTGCAAACCCGTGTCGACAAGAAAT
CTGCTGTTCCGCATTATCCACAACATGATACCCCACTCCTGTCACGACAGCCACAAGAGCCACAAAGAGCCAAATAGCGCAGAGCGAATACCTACCCTCT
GGTGCCTCAAGACGGCGTAAACGCAGACGAGTGTATACTTATCTCTCGCATTCGGAGCCCCGCGTGAACAAGCTGACATATGCGCAACAACGGTTTTTTT
TCGCAGCTCGAAAAACACCCAGCTCATTGAACCCATGCGCTTCAACAACAGCAGCCAGTACTCTCGATCGACCTC