Description :
From Genome Similarity Track
Location :
Scaffold_568:6981- 8895
Transcript NameFunction/comments
Phypl_g9465hypothetical protein PHYSODRAFT_341847
Phypl_g9466hypothetical protein

Sequence
1914 bases(100 bases per row)
TTTTTGCTGGGTGCCCACCCTGTCCGCTACTTGACGAGCTTCAACGACCACCGTTGCTTCTCAGGCACAAACATGAGTCGGTATTATGCGCCTCCCCGTC
GAAAGAAGTGCGAGGTAAATCATATCTCATCACCGAGCAGGCTCCGGCTGAtctcagcagcttccgcgaCGATGTTCAGTACTTGCGGAAAGTTGCTGTT
CGACATTGACGACCCTCACTACACCCCCACGTTCGCAAACAAtgtcagctgctgcagtgccgTCGACAACTTTTCGTTTTTTAGAACCACCGCGGGAATC
TGAGTCAGGGCTGGGAAGGCGTAGTCTCCGTCGTACCACGAATGATGTAGCTTCATACGTGCATACGTGAACCACTTCTCCACGTATGTCAACGCCTCGG
CAGCCCGTTCATCGTTTGGAAGGTAGTGGAGCGAGTACGTTCGGCTGGCTAGTGGGTCGTGGTCGGTCTTGTGGTCGCGGATGGTGAAGCAGCCGAACCG
GATGACTTTGTCTTTCCTGCGCGACTTGCGAAGAAACCCAATCCGAATGTAGGCTTTCTTTATGAGCAGAACTTCGTTGATTCGGCACATGTCGTAGAAG
CTGAGGGAACACACGGTCGAAAACCACACTCTCATCGTCTCGTTGAGCATCCCGTCGGACTCCAGGAAAGCGATCACTCTAGGCAGCATTGCGAGCGATA
TTGGCAACGCACACCTAGGAGTCCTTTCGTggttcttcgacttgctgaGGCCCGAGAGGATCTGCATGATGGCGGTCGAGCGGGCTGGATTCTCCCGCGG
CACTAACGTTCCGTTAGGCTCAGTCTCGATGACCCAGCGGTCATGTGGGTGACCCACATCGAGCATCTCCGATTTCGTGTAGTGCCAACTTAGTGCAGTG
CGGGTCTTCCCGATGGGCCACTGACTTGCATTCGACTTGGTTAGCTGATTGATGAATTCTAACACAACGCCAGGGAGCTCCACAAAGCGGTTCTTCTGTG
GGTCAGGGTAACCTTCGGCTTTGCAGAACGCCTCGAAGCGCCGAATACTGCCGTTGTAGTCGGTTCGCGTCATGGCTTCCAGTCGTTGATCCGCGTAGAA
GAACGCACAGAGCTGACGTGATGTCgtggaagtggaagcggTGTGTGTGTAtgggggggggagggggctTGCTTGACTGGATGAATTTAGAAATGAGGAA
TGGAGCTGGGGCGGCGGGGTCTTGCGCTCCGCTGCATGAGATCCAAACGGTTGGTGAGTGATGCGATCCCCAAATGGTTGGACTAAGAAAAATACAATCA
TATTATTCAgtattaaccctttcgtgagCCACCTTCCTAAACTATACTATACAAACTTAGGTCATTGGTATTTAGTCGCAGGTAGAACCTCTACTTTGAC
TTATTTTTACGAAGAAGGGATACTATATATCCGTGTCCCGTGCGACATGTGATCCACTGTGGTTTGCCGGTACAAGAGAAATGTTTTTTTGTAAGGAGAT
GTGATTACTGATAGCACCTTTTCTGACttgttataaaatacggttGATTctatgttgaacttgtgtaaaaggaaGCAAAATGCACCCATTAAGATGATCG
ATTTCAACCTTGTTATGTGGAGGCATTTTGCTCCCTAGGAATACGCTGAGCTCCAAGCGGCGGTTGCCCAACGATGGAGATGTTCGGCTGTGTGGATGAC
AAACCGCTCAACATCTACATGTGGATGCGCTGGATCATCCAACGCAGTCTCCCTGTCATAGAGATGGAGAACAAGCTCACACGCGAGGTGGTAATGACGA
AGCCGACAACCGTGAGAATGATCTAGGTCTATGTGCGGTTTGCCGCCGGCAAGGCCGGTCAGAAGATCTCCACCGAGATGGGAGACTCAGTCTGTCTAAT
GTTTGATGGGTGGA