Description :
From Genome Similarity Track
Location :
Scaffold_127:69802- 70831
Transcript NameFunction/comments
Phyke_g7749hypothetical protein PHYSODRAFT_288740

Sequence
1029 bases(100 bases per row)
CAGAACTGGCATCGACGGGCGAAACTTCGACACCAGGCGTGCAGTGTTGCCAGACTCCGTTAACACGACGATCATCTTCGCGTTGATGTCAATGGCAGTT
TTCACAGCCGACGAAGTAATAGCTTCTTGCGTATCCATTTGGCCGTAGGTATCAAGCACTGAGTTGTGCAGAGCCTGATAAAGCTCGTTGTAGTGGATGG
CTCCTTCGGCCTGCACGCAGatcttcgacatcatcatcacggCCTCAGTGGGGTAATCGCCGTTAGCAGTCTCACCCGAAAGCATCACGGCGTCCGTGCC
ATCCAGCACAGCGTTAGCAACATCCGTGCACTCCGCGCGAGTTGGTCGAGGGGCCTTGATCATCGactccagcatctgcgtgGCAGTCACCACGGGCTTA
CCAGCAATATTGGCCTTTCgaatcatcatcttctgggCCAAGAACACCTTTTCAGGCGGGATCTCCATGCCCAAATCGCCACGGGCAACCATGATGCCGT
CTGTCCTTGCCAGAATTTCATCAAAGTTCTCAAGCCCCTCCTGACTTTCGATCTTGGCAATAATCTTGATGGCGCGACCGCGGGGTCCTAGCACTTCGCG
GATATTGTCAATATCCTGTCCTGTGCGCACGAAGGACGCGGCAATATAATCAATGCCATTCACCAGGCCAAAGTTCACCAGgtcatcttcgtccttcTCC
GTCAACGTAGGTAGCGTCACTTTACAGCCTGGCAGGTTCATATTCTTGCGTTCACCTAGTGTGGCGGTGTTGTTAGCTCGCGTCACAATGCCGTCTTCCT
TGATCTCCGTCACCGTCAAAACCAGTGAGCCATCGGCTACCAGCACTAATCCGCCGACCTTCACGGAATTTGGCAGCTCCGGATACGAACAGGCGATCTT
GGTCTCATCGCCTAGGAACTCATAGTCCGTCGTAAGCTCCACTGTGGATCCTTTCTTGATGGTcaccttgtccttgttggCCAGGAAGCCCGTGCGGATC
TCCGGACCTTTGGTGTCCAACATGATGGC