Description :
From Genome Similarity Track
Location :
Scaffold_311:698- 3474
Sequence
2776 bases(100 bases per row)
GTACGTGTGTGCTTATCGGCGCCTTTTAATTATGCTAACTAACGCGTACACAGGCAGCGCCCTTTGCGTGGCCTTGCATACCGACGCTGAAAATGAGAGC
AAAATGAAATTTAAGCAGTGCTTTTAAGTACGATGTGTAGACCACATATAATATGTAAGAAACACAATTTTGTTTTTTGTAAATGGGGGCCGCCTTCGCT
GCGCTCGACAGCTTTTTAGCGAATCGACGCCGCCTTCGCTGCGCTCGGCAGCCAGTAGAACGCGCGTATTTGCGTTACATTAATTAACCCTAGCCCGTTA
CGGACGGACTGACAGACAGACACCAGACTCCAGTAGGGGGGTAAGACTAGCCGTTCGCCGCCGCTACGCGGCGGAGTGGCATGGTTTGTTGGAGATGAGG
TGGCCGCAAATTTAAGTGCTTCTTGGTGTCGCGTGTTTTGAGAGCGTGGTTCACCCCGTAGATCTTGGCATCGTGTATTTAACCACTTGCCTTTCCGTAG
TCTCATTCGGCCCCGTATAATATCGTGGTTTGGAACGCTTCCGTTACCCCGTACTACAGGTTAGATCTCTTGTTCTACAGTGGCCGGCGCTCTTCCGTGA
TCTTCCTGGCTTCGTGGTTCCCTGCTCACCCGTGGCACACGCTGCTTAGTAGTTAAGAGCTCTCTCTTTTGGGTTCATGTTTTTTTAGTACTGCGTCGTG
GCTGCTAACTATTTCCTGCTCTCAAACGTTTTGTGGGCTGCACCGGCTTTCTGAGACTCAGTCTTTCGTGACCGTTCGCCTCCCATAGCTGGTACTCTAG
CCGAAGGGTGCTTTTCCGTGGTTTGAAGCCTCCACGCAGTCGTGTTGTTCCAGCACCCGTGTATCGGGCTCGTTTGGTGAGGCTCCATCGACCGCGTTAT
AACGCCATCGTGTAATTGCGATATGGTTTTGCTGTCTATGGTATTGTGCTCGCGGATTGCATCTACTAGATGAGAATCCACCCAAGCCCATCAATTTGAG
CAAGAGGTGCGGCGGGCTGGGCGACCGAAAACAACTGCAGCGCAAAACTCCAAGAAACGAGCCACAGCGCGTAAGAAATTCAATACACGACTGGAGAAAG
GCGGAGCGCTATCATTCGAGGACGTCGGGGTTGTTGCGCGCATCCTTGGCGACATAAACATCAGTTTTACTAATATTTCCGAATTGCTGGATGTTTATCC
AGTACAGTATGAGAGTGCTGCCCGTAAGCATCCAAAAGTTGGTGGAGATAAGAAGCCGATTCTGAGTGCTGCTCTACCGTTCCTACTGCCTGCTCCATTA
GTGAAGAAATCCTTAGATGTAATCTACGAGTCTGGCGCAGTTCCGTTGCCAAGCCAAACCGATGAAGAACCCCTATACGTCAAGATTACCGGTATTGGCA
ATTTTTCGCTGTATCAAGTCGACTGCATGCAGAGAGTATGGACAATGAAAGAGGCTGTTGTGATGGGCAAGAGACTAGTGGAGTGGTTGAAGTGTGTACG
CGTCTGAAAGAAACAAGCAGAAGAAGTTCTTAAGCGCGTTCTACAAGCGCATCCATTTGAAATCGTGGAGGGTAATATCGGTGATTTGGATTACTCAACG
CTGTACAGACTCCAACCGAAGGACTGGATAAGCTCAAAGATATTTGAAGCAATGGGAGAGATTTGGAAAAGAAATCATAGCGTGACCGTGGTTACAACTG
CAGGGTTTAAGCTCAACAGAAAGGTCAAGGGGGTCGACGTGCCGGCTGGTCTGTTGAACAAACTTACGTCTATCACTTCCAGATTGGTGTTTATACCTGT
TAACTTTGCGCAAGTGCATTGGCACTATGATTATTGTCAACACGACGACGAAGAGCATTTTTGTCTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTCGGAAGATCACCCATTGGCGAGGGTACCACGATTACGGAACGCTATCGACCACGAATGATTATGGACACGAAGCCTGT
GGAATCCACGTAAACCCTTGAGAACACGGAATATCTAGCAGCCACGAAAGAGGGTCGTACTACGGGAGCGCATGAGACCAAAAAGGCTAGCACACAACCA
CTAAGCACTGTGAGAGAAGGAGTCCACAAACACAGGACAATCACTAAGCAGCGTGGGCCACGGGTGAGCAGAGAACCACGAAACCAGGAAGATCACGAAA
AAGCGCCGGCCACTGTAGAACATGACATCCAACCTGTAGTACGGGGTAACGGAAGCGTACCAAACAAGGAAATTAT