Description :
From Genome Similarity Track
Location :
Scaffold_238:6979- 10562
Sequence
3583 bases(100 bases per row)
GTGTGGTAAAGCCGATCGAGATCGAGAGGATAAAATCTAGGCTTCCGGCCAAGTATGAAGCGGTGTCTAGTTGAGGAATAGTAGGACGATGGCCCTTAAC
ATTTACGCCACCGCTGGATGACCCAATGGGCCGAACACCAACCTTCAGCGCCCTCCTAGACTATAAAAAGGGGACCACGATCAAGGTACTGCGATCAGTG
GACCGTGATCAGTGGACCTCGATCAGGGGACCGCGATCAATGGACCGCGATCCAGCGTGGGCCACTTGATATGGAAGGATTGCAAATCCTTTCGGAAGGG
AGGCGACACGTGGCAGCATATCCTGACCTACGGGGTAGGCATAGTCATAGTTTTAGTCTTTGGGTGGTTAACATTAAACAGAGTTCAATTTGCTTCTAAA
CACATTCGTGTCGTTCTTCTTCCGGGCAGGATATTTGGCCAACCGACGTCAGAGAACTTCGACACTACGAAATGGAATATCACTCCTGGAACTATTTGGC
CAGGAGTGCAAGGAATCTCAACACCCCTCACCTGCAATCGGACGCAGGCAACCTTACCGGTTGAAGTACAAGATCGAGAGACGGCTCAAGTGGTCAGAAG
TCTCGCGACTCAAGTACCCGTTTTTGGCACAAGGCGATCAAGGCTGATTGCGGCGACTCTGGGAGAGCGCCAACCGAGAACACGCGATCGGGTGAGGAAT
TTCCACCCGATTGACATCAATCTTTACAACGGACAAGTTTAGCATCGAGGCAAGTCCACCTAGAAGAGTGCAGCCCGCCCTACCGACGGGTACACAAAGT
GAGGAAGGAACAAGCGCAAGCAGAACCAGAGCACCCCCTCCGTTAGTCGGTTATCTGGGCGCCAGTGGATAGTTGGGATCGCCTCATAAAATGAGCGAAC
CCCACTTCACCACAATGGTGCGAATGCCCGGATCTTCTGGTGACTCGGGATTTCACTGTGAGTCCCGTGAGGAAGATGTTAAGATCAAGACAGATTATGA
AATTGAAGCTTCAGCGGAAGAGAGATTGCCACGGACGTGTGGAGAAAAAGGATTTACAGATTGTCAGAGTTTTGGGAGGGGCTTTGATGACAACAAAAAT
GAAAGAGGAAGATCTATCTGTAGATCTAGAAGATAAACCAGGACCCCCTCCTGAGATCCATTCGTGGACCACCGCAGATCCCTCTGAAAAGAGCGATCTG
CTGGATGAAAGTCCAACGGCGAAAGCCAAAACGGCGAAAGCCAAACCCTATGCCTTCGTCGATACATCACCAGATGTCAAGACGAAGAAGACGACAAAGA
ATTCTGACGGATTGGCGCGACAGGAGATACGAGCTCCGGGATCGGATCACCCCGATCGCGTGAAGAGATCGGCCATCTGGCCAATCAAGTTTGTGGAAGA
TGAGGGGAAGATGGAAGGATGGAAGCTGGAACAGATGGCGGAGATGTATCACTGGAGGACTATCAAGTAGTACTTGTCAAAAGATCCATTGCTCAAGATA
CTGAAGTTTAAGATGTTGGAACAATTCAAGGCCCTATATCAACCCCAGTTGTCGCGTCGAACGCACTGGATGGAATTGATGGGATTATACAGCTGCTGAA
CGAAGCGGTACTTGTCGCTTCAACATTCGACGCAAGAGAGCTGTTGGATTGTGAACAGGATCGCGTGATACACACGTGTCAATCGCTGTATGAGAACTTA
GCCCCTTTGACGGGCATACGTAAAGCTGACGGTCACGCGGAAGCGACTGTGGTGAACGATCACGTGAGATTGACGGATGAAGAATTTCAGAGAGGATATC
ACAATGAATCGTCCTAGTATGCCTCAGTCGAGTCTGAAGTAGAGTCAGGGGACTCAATCTGAATTCAGCGGGTGTCTTTAGGCCCAAGTGGAGCTGCTCA
TCTGCGCGATCGCATGGAAAAGAAGGCTGATCTTCGTGATCGCAGGGAAGGGATCGAAAGCGCGATCGAAACCCGTACGCGTTATAGAAGATGCGGGTTA
GACTACCCAAGGACAACTACAATCATATTTTGATGCTGCCATGGAACGATTTAAGCAGGAACACCGTAATCAGGCCCGCCAAGCAATCTACTCAAGTCAG
AGGATCACGGGTGCAAGGAATCTCGAGTCTTGTACCCCTGATGTCGATATGGAGTCTGTCGGATCTCATCACGGTCGCGCTGAAATGCAATTTCGTGAAG
CAGGAGATACCGACAACTCAGGGCAAGCCGAATAGAGACGACCACTTGTGGCTACTGCAGAGACAGTGCCAGATGGTAGGATTAGCGCTACGCGTATTCG
GATTTCTGCAATCGTAGAACTGAAAGAGTTCAATGGGAAGAACAAAGAGGAGGGTCGAGCCAGGAGATGGATTGGCAAGATCAAGTCTGCCTTCGTACGT
GATCAAGCCCCAGATGTGGAGAAGTGCTTGATATTTGGAGATCTGCTTACGGGTCCGGCGAGAAATTAACACAGTCAGCTGAGCCGATCCACTAGCCATA
CGTGGAAGGACCTGTTGGAAAACTTTCTCGTGCAATATGGTGGTAATGGGTTTGTCCGTTGGGAGACAATATTACCTTGCCAAGAAGCGACCAGAGGAGT
CGCCTCCGAATTACCCGTATCGTTTGAATGTGTCAGCGAATCGAGAAAAGATATGAATTTGAGATGGATCCCCAGACATTCGTCGTGAAAATGTTGAATA
CTTTATTGGGGCCCTGGACGATCGCAATCTGGCCAAGAAAATGACGCTGTTACGTATCGGGGATGTGGATGATATAGAGTAGACCCTATGTGCTTACCAG
CGTATGGAAGATCGACAAACTCAATCACTCATGGGATCGAATAAATTTCGACCACGATCCGCACCCACAGCTTCTCCAACACCGGCTTAACCAGCGCGTG
CCATGAGGCCCATTCATGTGGAGGATGCGGACAGTTCTTCGGACTCCGACCTTAGTGTATCGGACGCTGTACGTGAACTACGTAATGTATTTGTGGCCGC
GACCTTGGATCGCCCGACGAAATTCGTAGATCAACGTGGTACAACCGACGAGAATCGTCAAGATTATAGTCCGGAACGCGTCGCGTTTAAGAAAGCCTGC
ACTCATTGTGGATCGGAGAGACACGACGATAGTGGATGCTGGCAGAGACTGACGTGCCAGAAATGCGGTCGTAAGGGACATCCATTGGACAAGTGTTTCT
ATGTGTGTGCAGCTTGTGGAGAGATACATGAGAATGCCAAGTGCCCCATGGAGGATTTCTATAACTTGATCCGCAAGTGGTACGTGCCTACCAAACATGC
TGGGATGTTTCCTCCGAAGGTCGAGGAGATGTTAAACTAGGACGCTCGCCAGGTTGGAATCTGGCACGAGCTGAGCGTTCTAGGCTATGCATATATGCAT
TTGTTGAAAAACAGTTGGAGGATCAGGGAGTTAAGGTTCGGCGCGATCAGATCACTAATATATGTGATCGTTCTACATTAGTTTCTTCTATATCAAGTGT
GAAACGAGTGGACGATTATGCCCGATCCCCGGTGAAGATGAAGCTCAATATCGCCCCAGGGGATTCAAGAGAATACTGTAAAT