Description :
From Genome Similarity Track
Location :
scaffold_856:6979- 9187
Transcript NameFunction/comments
Pl_102108Phosphatidylinositol 4-phosphate 5-kinase (PIPK-D12/GPCR-PIPK)

Sequence
2208 bases(100 bases per row)
CATGGGGGCGTACGACGCCCTCGCAGTGGCGCAGAGTGCGCAGCTCTACGTGTTAGTAGGAGGAGTAGGCATCGTAGTCTACCTGCTGCTAGTGCTATCG
TTCTTCCTTGTACCCAACATCAAGGCGCAGCATCCAGCCGCTGACCTCGTCGTGTGGCACGCAGGCTGCGGCCTGATGACATCCGCCGGTTTCGTCTTCG
CCTTCGCTCTCCAACGACAGGACGTGGAGCCGCTGGACGAGTCGCTTATCCACTGGCAATGCTCGCTATTGGCGCCTTTCAACCAGTTTTTCTTCCTAGC
AGGCAATTGCTGGTACCTCATGCTCACGTTGGACTTGCTCGTGGCGCTTGTGAACCCCTGGATGGGCTACAGTTGCAAGTCCTGGGCCTACCACACAATG
TAGAGTGCCATTATACAGCAAAGTAGACTGATGATACCAAAACTGACCTTATCTATTGTCTATTGCTGCAGAGTGTGGAGCGTGAGTGCCGTGTCGGCGC
TGTTGCTGTATCAATTGAATCTCTTCGGTCTCTCGCCACTCAATATCTGCTGGGTCAAGCGCACTGACGATCCGATGCAGGTGAACACTGTCAATTGGAT
CTTCCTCTTCGCGGTTGTTGGAGTCATCTGTGTCGCCTCATTCGCAGTGCTGCTGTTCGCGAGCTTCCGCTTTGTGAGACGCCAATTGGATGTTACGTAT
CGCGCTAAACGCCGCAATTTGATCCAGTATTACCGCTATCTGCTGATTTTTGCGGGTCATTGGGCGGCGTGCGGTACTCTGTATTACGCAGCGTATCGTC
AGCAATTTGACGGCAAAATGGCGAAGCACTTTGAGCTCGCGTTCGCGCTAGTTTTTGGATCGTACCCTGTAATGCTGCTCATTGTGTGGGTGCTAAACAC
GGAGTTATACCAGAATTTCTCCAGTGAAAACAACCTTTCGAAATCGGAGCGAGGAACTGGAGTATCTACAAGCACCGAGCATTTCAGTGCTGCATTACGT
AAAGACTTGATGCGATACACGACTGCAGGGATCCGTTGCAGCATCAGTGAATCCCCTACAGACAGCCTGCGTTCTCCACTGCTCAGTCTGGCTCGGGATC
GTTTCGGCTCTCTTGATCGTTCTGCTGCGTTATCATTCTTGCAAATGGAAGAGGGCGGCTCGGCTGGTTTGTACCACGAGAAAAAACGGTTGGCAACTAC
AGTGTACAATGGGGAGTATCGATACTACGAGAAGTTGGGTTTCACTGACTACGCACCTAAAGTGTTTCAGAACATTCGTGAAATATGTGGCATTGACAAC
GAAATGTACGAGCAGTCTTTCGCTGACACACTCCTGGAGCGCGCGTCAGAGGGCAAGTCAGGGATGCTGTTTTACTTTACTAGTGACCGCAAGTACCTAG
TGAAGACCATGACGAAGAGAGAACATTCGTTCCTGCTTGAGGTGCTTCCACTGTTTCACCAGTATATTCTCAAGCAGCCCAACTCACTCTTGTGTCGCTT
TCTTGGCTGCCACTCGATGCAACTTCCCGTCGGGTGGAACAAGATGTTTTTCGTCGTGATGGAGAATATTTTCCCAGATGGGCCAGTTGATGAGCGATAC
GATCTTAAGGGTATTTTTCACCAGTCCAATTTCCGATATCAAGAAGGGATCGCAACACCCGTGTCAGATTGGAGCCGTAGTGGCAGGGAAGAAGGGGCCA
CGCACATTCTGGATGAAGACGAAGCAGCATCGAGCGAGAGCCAAAGTGTTGACAGCGAATTGGGACACATAACAGAGAAACAGCCACTACTGCGTCGTGG
AAGCTCGCGTCCTTCGCTCCGCTATGATAACGATTTTGTAATCCGCCGTGCTTCGCTTCGTGTGACCCCAACGACCCGTGCAAACTTGCTCGCGCAGGTA
ACGAGCGATTGTGGATTTCTCCAAGAGCTGGGGATTATGGACTACAGCTGTCTACTCGGCATCCGACATTATAATCAGCGCATTGAACCCGATATTATGG
ACAATCTGGCACACAATGCTGTCGTGTCTGCAGATCAGTCCACTGTCTACTACCTCGGGTTTGTAGACATATTGCAGCACTACAACATTGGGTGGAAAAT
GCAGCACTGCTTACTGGCTGCGGTGGTTGACAAGCGGCAGATTACGGCGCTTCCACCCGCGGAGTATGCACTGCGATTTCTAAACTTTATTCATGAGTAC
CTACTTCG