Description :
From Genome Similarity Track
Location :
Scaffold_45:69782- 72407
Transcript NameFunction/comments
Phypl_g1703hypothetical protein
Phypl_g1704arginyl-tRNA synthetase, putative

Sequence
2625 bases(100 bases per row)
GTAGTCGCTTGGTCGTTACGTGCGCATGCAGCCAAGAGGATAGCCCCACAGCGCGCTGCCCACGAGTtcggcggctgctgcggggCGATCCAGACAGCTG
GGCGCGCCGCGCCGAGCGCAGGACAGACAAACGAACGTCATAAGATTGCACTTGAGTTCGAGTTTGCTGGCTCGAGGCAAGCGACGAAGCGGCGGGAAGC
TctcgccagcggcggcagcttccaCGATGACGACGCACGCGGAGGTGGCTCCGCCGTCGGCATCGCATGGGCATGTCTCGGGTGCAGGCAAGGCTCTGCT
CTGGTCGCGCCCACGCCGATCGCGACGAGAGCTCTCGCGAACCTACACAACTCCTGCCCAGCTGGCCGGCAACCTGTggctgcgacgccgagcaccgCTT
CGTTGTGTGCGCGACTGAGCAACACGCGCGCGCCAGGTCGCCGTGTCGATCGGCGACCGACACTAAAGAGCTCGGCTCCAGCCGGAGCAGCTCGGTGGAG
TCGTGGCGCTCCGGGTCAGGCCGCCGAGATGCTCTGCTTCCTGAAAAGGCCGAGGCTGGCCCAGAAAGACGGACCCGGCGTGAACCAGCTCTCTGAAGTT
GGAAGGATCTTTGAATCGAAGACGAGCGCTCGAAACGGTCGGCGCTTGTCGCAGGGAGATCGATGCAAGGCAAGCAAGACATCTGGTCTCGGTTGCTCGG
GCCCGCTATAACACCGAGGTACAGTACGAGGTGTGTTGATGGATGCACCGGAGCATGGagcctcgctcgctgcgctgcggGCATTGGCGCGGAGCTCGCT
GCATGTACTCAGCCATCTGCGCGTGACGTCCACTTGCCGTGCCCGTCGCTCTCCGCGCGGCGTCGTTCGTGTTCTACCGATACGAGTTGAAGGCGTGCGG
TCGTCCTAAGGATGACCGCACGACAACTGCGCCAGTGCCAACAACAATCACAGTGCCGCGCTGCTTACGGCTTTCGGCGGAGGCGATGCCGGTGGATTTT
GCAGAGCTGCTGTGCAAGTCGCGAGCGGGGCTCGTGTGGCGGAGCGCCATACAGCTAGCTCTCTGTCAGATAGGCAGGCGTCGGAatcctgcagcaggat
cgTACGCCACGATCAGTTCAATTGCAGCGACCGGCACAGCTTGTCGCGCATGGATACCAggcaaccagcagcacaacgttgtctgtctgtctgtctgtct
gtcaGCGACGGATGATGGCGTAGGGTCGAGTGCAAGGCGCTCAGGGTCAGGCAGCGGAAtcacggcgccgccgccgcccgtcgcacaacgtcgtcgtccg
tccCGCGCGGCGCCAGAATCCATCCTGGAACTGCTGATCTCCACCGATTGGCACGCGAAGCTACTTCAATTGTCATCGCTACTCTACGCGCGCCGAGTTC
ATGGCGACGCACTTTCTGCACTACGAGCGCTCCTCCAGGGTGGCCACTCCACGGCACACGCCTTCGCCCACCTGCTCGCGAGCTgcacaccagcaccatc
tcCGAGTGTGTTTTCATTTCGCAAGTTGCTTCAaagcgcaccagcagctccgatCCGCCGCCACAGCTCTCGCCTTCGGCTCGACGAACGCAAcctcagc
agcaacaccatgaccagcaccagcgccgacttTGAGCTctccgagctgcagaagtacTATCACCTGCCGCTGCGggaagctgcgcgccgcctcGGCAGCT
GCGAGGCCGTGGTGAAGCGCGTGTGCCGCCGGAAGCAGATCCAGCGGTGGCCCTACCGGCAGGTGTCGTCCAAGCTCATCAAGATCCAGCACCTGTGCAA
GTACATGGCACACGTGTCGGACGCCGAGCAGAAGGCccgcatccagcacaagatcaagcagctcacaCAGGAGTAcctggagctcgtcggcggccAGGTG
CcgtccgagctgcagctcacgccCGCCGAcgtgccgacgctgccgccgccgagctaCAAGGGCGACAGCCCCATGGAcccggccgtgctggccgctgctt
ccgacgatgacgcgggtcgcgaggaggaggacgaagacatGGACGACGCGCCCGAGTCGTCCGGCGAGAGGCGGCTGTCGGCGtactcgctgcgcttcat
ccTGTCCGACTGCACCGTGCTGGAGACCGACACGGGTCTCCAGTACAGCACCACCGCTTAGAGCTCGCCGGCCCGGCGTCACGATGTACTGTACTTTGCC
TGCATGTCCAACAACTACGACGACAAACATACCGTCACCCAACTCTGCATGTTAGATAGAGCCTTCACACGATCACCAGCAAGTCCTGGAGAAATGCGTG
CAAGTTAGAATTTTCCTAATCAAATATTGAGCTTCATTTCGTTCATTCACCTCGTTGCCTCACCTCGTGGATGACCACCGAACGAACCGCTTCttgcctg
cctgcctgcctgACCGCGAGCGCCTTAGATCTGGTCCAGCGGGTCGATGCCCAGCAGTGAGAAGCACGTCTTCATGACCTTGAGCGTGGcgtcgcacagc
agcagacggcTGCTCTGCTCCTCGCTACCAAGCACTCGGCACGCCGTGACGAACGTCTGCACCTTCTCCGAGATCGTGTACAGGTAGCTGCACAGCCGGT
TGGAGCTCAGGTCCTTGTTAATGAA