Description :
From Genome Similarity Track
Location :
contig_10:6975- 9617
Sequence
2642 bases(100 bases per row)
TTTATGCACTAACCCTGAATGACTTGGATTTCTATGCATGACTTCGAGTTTGTATGGCCCCCGAACATGATAAATTGACCGAAAATGGTCGCGGAGTTTT
CATATAGGAAACCCGAGCCAAAAATGGGAGGACACTCACCTCGGAGAAGACCCGGAGCGTTCATATAGGAAAGCCGAGCCAATAAATGGAGGACACGGAG
CACCGGCCTACCCTTCTCCGGTTTGTCTTGATTTCACTATACTGTCCTCTCGTGTATAGGGACCCTCTACCCCATACAAACGCCTTGTCGAGTAGTCATC
GCACGATAGTAATACCATGGAACGGAGCACATTCTGAAACGTAGAGTCCCCATGTTTCAGAGCTCTAACGTTGATATTGAGGAAGTTGTAAGAAAGTCCA
TAACGGCTCGTCCGTTGAGAAATAGTAGTACCATTGAACTCCGCACATGTTGAAACGTAGAATCCTACGTTTTCAATGCTCTAACGTTACTATTAAAGAA
GTGTGTAAAAAGTACAGAGAGGCAAGTCTTTGACACACGCGAGTCGGTGCATTCAATTCGCCATATGTATAAACACGGATTCCCAAGTTTTCAGCTACTC
CTGACGATGGTAGTTTTTCTATCTCCTGATTGGCTAGGAAGCTGTGCTGTCGAGGTTTATGCACTAACCCTGAATGACTTGGATTTCTATGCATGACTTC
GAGTTTGTATGGCCCCCGAACATGATAAATTGACCGAAAATGGTCGCGGAGTTTTCATATAGGAAACCCGAGCCAAAAATGGGAGGACACTCACCTCGGA
GAAGACCCGGAGCGTTCATATAGGAAAGCCGAGCCAATAAATGGAGGACACGGAGCACCGGCCTACCCTTCTCCGGTTTGTCTTGATTTCACTATACTGT
CCTCTCGTGTATAGGGACCCTCTACCCCATACAAACGCCTTGTCGAGTAGTCATCGCACGATAGTAATACCATGGAACGGAGCACATTCTGAAACGTAGA
GTCCCCATGTTTCAGAGCTCTAACGTTGATATTGAGGAAGTTGTAAGAAAGTCCATAACGGCTCGTCCGTTGAGAAATAGTAGTACCATTGAACTCCGCA
CATGTTGAAACGTAGAATCCTACGTTTTCAATGCTCTAACGTTACTATTAAAGAAGTGTGTAAAAAGTACAGAGAGGCAAGTCTTTGACACACGCGAGTC
GGTGCATTCAATTCGCCATATGTATAAACACGGATTCCCAAGTTTTCAGCTACTCCTGACGATGGTAGTTTTTCTATCTCCTGATTGGCTAGGAAGCTGT
GCTGTCGAGGTTTATGCACTAACCCTGAATGACTTGGATTTCTATGCATGACTTCGAGTTTGTATGGCCCCCGAACATGATAAATTGACCGAAAATGGTC
GCGGAGTTTTCATATAGGAAACCCGAGCCAAAAATGGGAGGACACTCACCTCGGAGAAGACCCGGAGCGTTCATATAGGAAAGCCGAGCCAATAAATGGA
GGACACGGAGCACCGGCCTACCCTTCTCCGGTTTGTCTTGATTTCACTATACTGTCCTCTCGTGTATAGGGACCCTCTACCCCATACAAACGCCTTGTCG
AGTAGTCATCGCACGATAGTAATACCATGGAACGGAGCACATTCTGAAACGTAGAGTCCCCATGTTTCAGAGCTCTAACGTTGATATTGAGGAAGTTGTA
AGAAAGTCCATAACGGCTCGTCCGTTGAGAAATAGTAGTACCATTGAACTCCGCACATGTTGAAACGTAGAATCCTACGTTTTCAATGCTCTAACGTTAC
TATTAAAGAAGTGTGTAAAAAGTACAGAGAGGCAAGTCTTTGACACACGCGAGTCGGTGCATTCAATTCGCCATATGTATAAACACGGATTCCCAAGTTT
TCAGCTACTCCTGACGATGGTAGTTTTTCTATCTCCTGATTGGCTAGGAAGCTGTGCTGTCGAGGTTTATGCACTAACCCTGAATGACTTGGATTTCTAT
GCATGACTTCGAGTTTGTATGGCCCCCGAACATGATAAATTGACCGAAAATGGTCGCGGAGTTTTCATATAGGAAACCCGAGCCAAAAATGGGAGGACAC
TCACCTCGGAGAAGACCCGGAGCGTTCATATAGGAAAGCCGAGCCAATAAATGGAGGACACGGAGCACCGGCCTACCCTTCTCCGGTTTGTCTTGATTTC
ACTATACTGTCCTCTCGTGTATAGGGACCCTAAACCCTAAACCCTAAACCCTAAAGTCTACTATGCTAAACCCTACTATGCTATTTTAAACCCTATTTTT
ACAAACCCTATTTTCACAAAAAATGACAATTACCAAATTTATCAACACAAAATTACAATCTTTTCTTTTCTTCTACTACCTCACATTACACCACATATTG
CACCTTATCACATATACTTCACCTTTTTACCATCTCCATATCACTTCAATTTTTACTTTTTCTCATCTTTACACACTTTAAATGCAATACTCCTACATAC
ACTTTCCCCAATTATCGCATCCCCACCTATTCCACTTTCATCACACTGCACATCAACACCTTTCTTACTCTCTATAACCACCACCCCATACTTCTTTCTC
ATTCACTTACTATATATATCTACCCATTCTACTTCTACATAC