Description :
From Genome Similarity Track
Location :
Scaffold_165:69738- 85238
Transcript NameFunction/comments
Physo_144093hypothetical protein
Physo_144094hypothetical protein
Physo_109608predicted protein
Physo_144096hypothetical protein
Physo_109609Caltractin (Centrin)
Physo_144098predicted protein

Sequence
15500 bases(100 bases per row)
CCTCAAAGCCGCTCCAGCGTCCGGTTGTCCACCTTGGCCTCCTCCTGCATCGATTTTCTGTCAAAGACCTCGTCTTCTTCATCGCTGCTGCTGTCCTGGC
CATGGTGATCCTCGTCCTCCTCCTGGTCTAGTCGCTGGTGGTTCGTAGAGCCACCTTTCTTGTCATTGCGAACCAGGCCGAACTCCTCTTCATCGTCGTC
GTCTTCATCCTCCTCGCTTCCCTTCACGCGACTCCAGAGCTGCTCCTTGCCTGTCTTCTCTCTCCGTCGACTGACCGAGATCAGCATCATCAAAAGGAAG
CCCACCACTAAAACGGCGCCGACGATCGTGAGCACCATCGGGTGCGTGCCCGAAGACTTCTCCTTTGCCGTTAGGTCTGCGGCGTCAGCTGAAGACGACG
CCTGTGTCTTTGTTGTTGCTTCCTCCGAGAGCGGCTGAATGTTCTGGACCGAGTTACTTGAAGCCGAGTCGAGTGCAATAGAAGCCTCATCTACTGCAGT
TGCCGGTGTTGCAGCGGCAGTAGCGACTGGCTCCGATGTGGCTGTAGCAGAAGTGGCTTCCGGGATAGACTCCTCCGTCACCTTAGGTGTCGAGGCGGCA
GTAGCTGTTGGCGCGGACGTAGCCTCTGCAGAGGTCGGTTCGGGCGTCGTCTCAACTGTAGCCGACGGCGTTGCAACAGGCTTTGGTGCGGTAGTCGTTG
CAGTAGCGGGCGCAGCAGTCTGGGCAGCGGTGGGTGCCGCAGTTGGCGCACGACTGGCAAAAGTAGTTCCTGCTACTGCAGACGTGGAGGCCGGCACGGA
AGCGTTTGAAGCAGCGGTGGCTGCGGGAACGGCAGTCGTTTCGCTGCTGTTGCTGCTGCTGGTAATGTGATCACCGATCGATGGTGGCGTCGTCTTCGTC
GAATTACCACCTTGGTAGGCGCAGTCAGCGTCCACAAAACCCACTCGTTGATTGCCATTGTCGAAGATCACGTCACGGTTCATCATAAGGTTGGCACCAA
TGACGCCACCGGCGTTTTCCGACAGGTAGATACTACCGCAGTACGAGTTGTCGTTGTGCAGCAAATATTGCTCGGGCGGGATATCGATGATCACTTCACC
GTTCTCGTCTCCATACGCTTCCATCACAAGCTGAATTTTCGGCAGCGACGCGAGATCCTCATTCGTGTAGCCATGACACGACGTTCCAACCTGATAGTCA
CGACCCGCGACTTCCTTAAACACCTGCAAAAACTCGTTCTTCATCGCTCGCGGCAGATAGGAGTCGGTGGTTCCACTATCGACAATGTAGTGGCCGCGAG
TGTACGCCTCCTCCTTGGCATTGATGGATTTACCACCGATGCGGATGTCCTTCATGTTCACATTGTAAAAGTGGCTGCAAAACCACACACGCGCATAACG
AATTAGCTTACTAGATACACAGAGTTCTGCGAAACATGGCAGCCCATTCTTACCCGGCAGAGCGGTCCTTGATCACTTTAGCATACGAGATTTCTCCGCG
GTGCGCCTTCGTGTTAGGTTCACCCACCGACATGGTGCCGCCGTTCTCCGTGAAGCAGAGCGAGAACAAGTTACTCGGAATCTTGTTCTCGCGGTGCAGC
TTTGCCACAATGTGGGTGTCCGAGTTGGACAGTCCCATGATACCGTCCGCCACTTGCGTGACGAACAATCCCGTCTCGGAGCTCTGGCAGCCGAACTGGA
AGTGGGTTCCGTACCGGTCGCGCATGGCTTCGTCGTGGAAGCTCGACTCGCCTCCGAGGTAGACCACGTCCTCCACCACCGACGCCTTCCAGCTGCTGCC
TTCCATGTACGACTGCGAGATCGCGCACGTGTCGGACTTCTCCGTGCACTCCTTGCACTGGAAGTGCGACTGCTGCTGGGAGCACGTCACGTGGATCAAC
GTGGACGAGTTGTCCGCCTGGAAGGGCTGGTCCGTGTGGCTGCCACAGCCGTCACAGCCCGAGCACGGGAACGCCATCAGTCCACTGCCGGTATCCGCGA
TCACCGACGCGCGCTGCGGCGGAGTGCCGGCGTACACCCACGTGTAGTGCGTGCTGCATGCAATAACCACATCAGTTCCTTCAATTTCCAGCCCGTCTAC
TCAGATAATCGACGTACCCGAGGCCCAAGTGCAGCGGGACGATCTCCGGCGCGTCCTCCTCGATGTTCAGGCGCCTCGCGTATCTATCCGGGTGGATGCT
GTGCTTGGGCAGTGGGTGCAGCTCCATCGTCATGGCTTCAGCCAGCGCGTGGAGCGACGCGGACGCCGCCGCGAGCGCCGGGAAGCTGGCGATCACGCGC
ACCATGTCTGAGTCTAGCGCTCGCTTGGATGGAGGTGGCAAGCTGGGAGAAAAGCCTGTGCCGGCCGATGCGCGCGTGTACAGTGAGGAGGAAGAGAGCT
GGAGGCGGATGGGGGAGCACCTCGGCACGTGGCGGTTTTCGACGTCCTCGAACCCAAATTAACTAACAAAAGTAAGTTTGGGCGATAGAAACGATTTAAC
CCTTTCGTGGCCAAAAGGTGCATTTTGACCCCTTAATTTTGGGCGGAATTCAGAGTAAAGAGCCAGAAAAGTATCTTTTCCTGATGGCTACATGAAATAC
CGCCGCTGACACTAGTCATTGAGCCCCATTTCGCGGCGCAGCAGTGTCGACCATGCGCTGGTGCCGCGGCGCTGGCGCTGAGCAGGAGAGCGCGTCTCGT
TGCCGTCTTCGGAGGTTTTCTTGGCGTTCGGCTGCACCGAGAACGCTCGCAACGTGGCCGTGGAGTCTGCCATTCGATTCGCCAGCCCCACCAGCGGAAT
GCCGAAGCGAGAGTGAGGAGACCCAGCGCCGCGAGGTGATGCTGCAGCGCTAGGGTTCTTTTTGGCGCTGTTTTGGACGAGCATGTCGTGGCGGATCTCG
TCCAGCAGCTGCTGGCATTTCGGTGACACGATGCGCCGTGACGCCATCAAGGCGCCTGCGTTTGGATCCGTTGGTAGTGCGGCTTTCATGCTCAGCAAGC
GCTTACGCAGCACTTCGTTGTCACCATTGCGTCGATGCTGTGCCAGTAGTGCGGCTGCCTTTAGCTCCACTTGTGACCCGTCGGCGTGGCCGCCCTGATT
ACCAGCGGCAGCGTTGTCGACCTCAGTAGTAGCAGGGTCAGAGTCGCCAGACGTGTACGAGTGTCGGTGGCGCGGTATCGCCAACTGATCCGCGGTCATG
ACGCGGAGTTCACCTGTCAGCTGTAGGTCGGCTTTCACTTGTTCCGCGCTGTTATTGGAGCCGTGTGCAAACGGAGGGAAGTCGCGCTGTTCAGCTCGAA
GCAGCTTGTGTTGACTCCAGGCAGACAGAAATTCCACTGCAGGTAGAAGTGTTCGATGATCCTCGAGACTTTCGTCCACCCAGTCGATCTGCTGCAGTTG
ACGCTCGAATTCGAGCGCTTCACCTGAAAGCACGTGCATCTTCACCGAAACTGCGTCGTCCAAGTTCCGCAGAGCGCGCGCACACTGCTCCTTGATCGCA
GCCGCGACTTGGGCCTTGTTTTCTTGCACGCTGCGCTGCACCCGCGTCAAAAACTGCAGTTTGTTCTCGATCACGGTCTTGCGCGATGTGATAAGAGGGT
CTGGCCTCAAGGACTCGCGTAGGCAGCTCTCGTACGCGTCCGCTACAGTCAGCAGTCGGTGGGATCCCCTCTCTCCGATCGAGTGGTCTCCCAACATTTT
GCAGCTGACACACACGGGAACTTGGCATACAGAGCAGTAGAACTCGACTTTCTTGCCGCGGTGAGTACGGCACGTTGGTGTCTGTGTATCGTCGGCTAGC
AGACCTTCCTCCATCTGCTTGGCGACGATCTCATTTATCTGCGCTTCTGTTGGGTCTGGAGACAACGGTAGACTCGACAGGTTTTCCACTACGATATCCG
CGATGGCAGCGGCAAGAGCAGGTGTCGAACTACGACGACGTCCACGTCTGGCACCACCACTAGCCAACGCCTTGGATTTACTACGCAATGGTATACGCTT
GTGGCGCCGCACCAACTTGTTGGCCGAGTGGACCTCTTGATCACAGTGAGCGCAGATCTGAGCCTCGCAGTTGCGGCAGATAACAACAGCGGGGTGCTGT
TCACACAGAGCACACGGTCCTACAGCAGGCCCGTGGGCATCCGCTGCCGAAAAGGTGAATTTCACGAGGTACTGCGGCAAAACTTGGAGAGTGTTGTTGA
GGATGTACTCGTGATAATAACCCCGGTCCAGCAGCGCGGCTTGGACGTCCTGGTCCTTCTCGCTAGAGCCACCTTCGTCCTCGCGGTGCAGGTAGTAGCT
GTGGTAGCCACGCGGAAGGCGTGCTTTAGCTTCTTCCTCGTCTCGAATGACAAGAGATCGCCCCACTGCAATCTTACAGAGCACTAGCTGCCGAGTACTC
GACGGCTTCTTTGCTTCGGATGCAGCATCCAGAGGCGCGCTGAGCTGAAGGTTCCCTGTCGTGAACTTCATGCCTGTCTGGTTGGCATCCAGCGACGTAA
AGCCATAGCTGTGCACGTCTCCCATGTCGGCGCCGAGATCGTTCACGGCGACCCAAGACTCGAGCTCCAGTAACCCCGCCGTGTGTTGCTCATACTGTGC
CACTAGCGACGGGTTCCGCATATCCCAGATCACAACGCCCTCGTGAACTCGGTACCCCGGCAACGAGCACTGCAGTAGGTACTTGACGCGCGCGAACTCC
TTTGACGACTGACTCATGGGCGTCACACTGGCCACGGCTCCTGCAGCAGGGATGGTGGCTCGTCGCCCACTTTCTTCTTCTTCATCATCGTCGTCCACGA
GAACTTCAGGGCTAGAGCCAACGTCTGCCCCGTCGTTTGCTGGAGCTGTGGATGAAGCATCGTGCCAGCCTTCGCCGTCACCATCTTTGTGAGCGTCTGT
TGTTGAGCGCTTGGGGGACGCCGGCCGCGCAGCCTCACCTGGTCCGTTGGGGGCATGCGACGACAGGAACAGCCGCAGCCGAGCCAGGGAAGCGCTAGCC
TTCGCATCGTCGGCCTCGTTCACTACCATGGGCACTGGCCTGGAGAGCTTATTCCTCCGTCCAGAAGTGTCGATGCGACTGAGTCGTTTCGCAGTGTCCG
TTCACGCCTTGAGCTACAATTGGATCGCATGAACGGGCTGATGCCGTAGCCCTGCACCAGTACATGCACTGGGGCTGCGAACTCATGCCAATTGATCCAC
ACGAGCAGTATCGATATGCGTGGTAGTCATGTCGCCTAAGCGAACAACAATATGGCTACACAATCTTGCTTCAACATCGAGCTTCAACTTCGGTACCCGG
TAATTCTCTCCACCGGAATGGGCCTGACAATGCAGGATCCTCCCAACTCAAGCTTCGAGCATTGCCAGGTCGGGTAGGACGAAAGAACTCGTCGTTCAGT
TGCCCAGGCGAGCGAGGTATTGACAGCAGAAACTGCAGCCCATGCTCTTCCACCCAGCTGTAGCCGTCGGCAAAGACCGCGCACAAACGTTGCTGCGCCT
TGTTGTCGATGCAACGCACACAACAATATATAGGCCTCGCCGCTACAGCAATACCCAGCACCAGCAGCAACAACAATACATGCACATGTAGCAGTCACAG
CGCGACCAGAATCCGAGCCTGCAAATCAGCGCGCCAAAACGCGGGTAAACGGGTGCGCGTTCCCGCCAACCAAATTCAAAGCCTACCTGCGAAAACACAT
AATATATCGATTTCCGCAGGCCTTGAACCGAGGCTCCAAGCCACCAACCAATCCGTCCCTAGTCGAGTGTGACGTCCGTTCCGCCGCCTCCATTCGGGCA
TTTGTCGCCAGCAGTGGAAGTCGCGTGACTCGTCTCCCCCCGCACCCCCCTCGCTCTCTCCAGCAGCATCAGCACGATGAAGTACCTGGCAGTGACCGGC
GGCACCGTGAGCGGCCTGGGCAAGGGCATCACCATCAGCAGCATCGGCGTCGTGCTCAAGTCGCTGGGGCTGCGCGTCACGTCCATCAAGATCGACCCGT
ACCTCAACTGCGACGCCGGCACCATGTCGCCCTTCGAGCACGGCGAGGTGTTCGTGCTCAACGACGGCGGCGAGGGCGACCTGGACCTGGGCAACTACGA
GCGCTTCCTGGGCATCACGCTCACGCGCGACCACAACATCACCACGGGCAAGGTCTACACGCACGTGCTGGAGAAGGAGCGCCGCGGAGACTACCTGGGC
AAGACGGTGCAGGTGGTGCCCCACGTCACGGACGCCATCCAGGACTGGATCGAGCGCGTGGCGCAGATCGGCGTGGACGGCAAGCACGCCGGGGAGGCCG
GCGCCGTGGACGACGAGGAGGCCGACGTCTGCCTCATCGAGGTCGGCGGCACGGTCGGCGACATTGAGAGCATGGTCTTCCTCGAGGCTCTGCGCCAGTT
CCAGTTCCGTGTCGGCCCCGAGAACTTCTGCCTCGTGCACGTGTCGCTGGTGCCCGTGCTCGGATCCGTCGGCGAGCAGAAGACCAAGCCCACGCAGCAC
GCCATCAAGGAGCTGCGCAGCGCCGGTCTGTCGCCCGACGTCATCATCTGCCGCAGCAGCACCGAGCTGGAGCCGTCCACCAAGTCCAAGATCGGCATGT
TCTGCCAGGTGCCCGCCAACCACGTGCTCTCGGTCCACGACGTGAGCAACATCTACCACGTGCCGCTGCTGCTGGCCAAGCAGGGCGCCGCCAGCATCCT
CATGTCGAAGCTGCAGCTCATGGACCGCTTCAGCGAGCCCGACCTCGACGCCTGGTCCGCCATGGCCCACCGCGTGGACTCGTTCGAGAAGGTGTGCAAG
ATCGCGCTAGTCGGCAAGTACACGGGTCTGCAGGACTCGTACCTGAGTGTCATCAAGGCGCTCAAGCACGCCACCATGAAGTGCGACCGCGACCTGGAGA
TCGAGTGGATCGAGGCCTCCGACCTGGAGGTGGAGATGCGTGAGAGCAACCCTAAGGCCTACGAGGAGGCCTGGCAGAAGCTGCGCAGCGTGGATGGTAT
CGTGGTGCCCGGCGGTTTCGGTGACCGTGGTGTGGACGGCAAGGTGCTCACGGCTCAGTACGCTCGCGAGAACAAGATCCCGTACCTTGGTGTCTGCCTG
GGTATGCAGGTGGTGGTTATCGAGTACGCCCGCAACGTCATCGGCTGGAAGGACGCCAACAGCGAGGAGTTCGACGCCAACGCTGGACACAAGGTGGTCG
TATTCATGCCCGAGATCAACCCGGAGGTCATGGGCGGCACCATGCGCTGCGGTGAGCGCCGCACGATTGTGCACGAGAAGGAGGACCCGGCGAAGCGCTC
GCTGGTGTCGTACCTGTACGGCAAGGACACGCCCATCCTGGAGCGTCACCGTCACCGTTACGAGGTGAACCCGGAGCTCGTGCCTGTCATTCGCGAGGCC
GGCCTCAACTTCGTCGGCACGGACATCAAGGGCGAGCGCATGCAGGTGGTCGAGCTGGACCGCGACGTGCACCCGTTCTACTTCGCCACGCAGTACCACC
CGGAGTTCAAGTCGCACCCGAACGACCCGTCGCCGCCGTTCCACGGCCTGATCCTTGCGGCCACCGGCCAGCTCGAGCAGTTCATGAAGAACGTGGAGGC
CAAGGAGAAGGAGCAGTAGGCGACTGGATGAAAATACTGCGACGCAGGACAAGCGGAGCCGACGGATGAAACGACGGACGACGACCCCGTTTCAACTCGC
GTGGAGCAGCACATTTGCGTGTGAATAGGCTAAAATATTGACTTGGAACCCCCAACCTTGCCTTTGCCTCTGTTTTTCTTCCGTTGAAGGAAAACGGGGC
GAAGCTCTCTCGGTGGGGTTCCGTAACCAGTCAGCCTAGCCTAGCACACCACCGCACACAGCCAGCTAGAACCCGGTAGACTCAATCAATCCAACATATT
TATTCAGAGCAGGACACCGCTCCATCTTCATTGCTACAGCATCTTCAGTTTCGTATTGAACACGCCTTCCAACATGGCTACATCAGACTTGGCTACATCT
GAACTTGCCCCTTTTCGGCGAATCAAATCGTTGATAGTGGCACTCTTCGTCAGCACAACAGCAGCATTATCATCGAGATGGCCGAGGAGCTGCAGGAGGC
GCTGGACGGCTTCTTCCTGGCGGCCGAGTACGGCCGCTCGGACGTCATCAAGGCACTGGCGGACCACGGGCGCGGCCGCCTGGCGCTCAGCGACGTCGTG
GACCCCGTGACCGGCCGCTCACCGCTGCACGTGGCGGTGGCGAGCGGCAAGAAGGACGCGCTGCGCGTTCTGCTGGCCGCGGGCTTCCCCCCAGCGCACC
AGAGCAAGCCGCAGGACGGCGCACAAGGCGGAGATGGCGATGGCAACCGGTCGGCGTACGCGCTGGCGCAGCAGTTGAAGGCGCACGACCTGGTGCTGGT
GTTCCACCAGTTCCTGATCCAGCAGGTCGCGGCCGACGACGTGCAGAGCGTCGAGCAGGTGCTGGCGGCCGGCGTGGACGTGGGCGTCACGGACGCAGCT
ACTGGGGGCTCACTGCTACACTGGGCGGCGTCCTGTCAAGCGACTGCAGTGATGAAGACGCTGCTGGAGAGGGAGGACGTGCAAGCGCTGAAGCTGGTGG
ACTCCCGCAACGAAGAAGGCGCTACGCCGCTGCACTTGGCGTGCGATGTGAACAGCGTGGAGTGCACGAAGATGCTGCTAGTGCATCATGCGGACGCGTC
GCTGCGAGGTGACAAGGGGATCAGTAAGGACAAGACGGCGGCGGAGCTGGCTACAAAGGCCGAGGTGAAGGAACTGTTCTCGCAGAGACTGGAACAGATC
GATGCAGCGGAGAAGACCAAGGAGATGGAGATTGAGAGTGGAAAGGAAGGGGAGACTGCTGAAGGAGACAGTGGAGGTGCATCGTGTGGAGAGGTTAATG
GAAATGATGAACGACGAGGGTCGGGGGCATGTCCGCATGAAGCGCAGAACGGCAAACTGCTGTTGCAACTTGAAGAGAAGGATCTGCTTGTGAACCAGCT
GAAGAAGACGATCGAAGCGCTCGTGCTGGAAACGCAGGAAATGCAGATGCTTGGAGAGGAACGCGTAATGCTAGACTACGTACGCAAGCTGCGTGACGAG
AACGCTATTGTCCAGAGGCAGCTTGAAGACGCCAACGACTACATTAAGGATCAACAGCAGCAGCTTGATAGCTTGAAGGAGCAGATTCGACAGATGGCAA
GTGCGAGCAAACAGGTACGCAGACCAGAGCTTGCAAGATGATGGTGGGCGTGTTCTTACAGCTACTTCTGTTGTGAAACAGATTGAGACTGACCACGACA
TTCTCTCTCATACCAGTGATGGCACTGCCAGCAGCGTCGCAGGTGGGCCCCCAGACAGCACCAACAGTAACATGAGCGCACTGGACTTACATCAGCTCGA
GACCCAGCTTGAGGAAGAAGAGGAGGAAGAACCGCAGCAGCAACCTCGAGCACAGCCGCTGAAGCTGGATGCGTGGACGTCAAAGGCACAACGTGAGCAA
GAAACATTCAATCGTTACGTCGAAAAGCATGGGCCTGACATTTGGAGCACTGTGTGGAATGGCATCTGGGCAGGCAATGAAGAGAAAGAGACGCAGGATG
AAGACGGTGAAGTCATCATGACAGTGTAGAATTAAATGGTCAGTGAATTGGATGAATTTTCAACGATGGGAAGCAGGAACTGAGCTAACGGATTGTCGAA
GCAGCAGTCGTAGTCGTGTCTTGCTGCTGTTGCTTGTACACACTTGCGAGGAGCTTTTCACGCTTCTTGGGCTGGTTGTACAAAGCGCAGTTGTTGGCAC
ACGGTTGAGACGACGAGCTAGATTTTGAACCAGCTTTTGCACATGAGCACAGGGCGGGAGTTCCTAGTTGTGCTTGCAGAGCTCGAATGAAGCGCTCATG
TTCTGTCGCCGCTACCTCTTTTGAGGAACCTTTAGGGGTTTTCTTCCTCCACGGAGTTGACGAGGTGGTGGTTTGGCGGTGCACTCGAGCGTCACATCCC
GATGTCATGTCGATCCTGAGCGCCACAACGAAGTGTTAGATTACCCAAAAGACGAGATACGACAGGTTTTTTTCTTCTTCACGCACACTTTGACACCAGT
TGCGGTAGCCCAGCCTTCGACAGAGCTGTGGCTACCGGAGTTATCAGCTCGACGAGCTCTACTACCACGCACCGCTGCTGCGATTGAGGTGTTCGACAAG
GGGGACTTAGCTTTACTTGTACCAGAGTTGAAAAGCTTAGCCGCTCGCCAAACATTTTTCTGGATTCTGGCTCGATTCATCTCCATGTATTGTCGTCTCA
CTGTAGCGTATAGGGCCACACGCTGACGCAGATTGAAATCCATTAGCGTGCTGAGCTAGTAAATTATCACCCATGAACGCCCCACTTACCTGCTCTGGAA
GCAAGACTGGCGACTCAGGTGGCAAAACCACGTCAGCAGGGTCTTCAAACTCGGATTTGACGTCGATATAGCTTGCTGAGCGTGAGATTTCAGTCGATCG
AAGAAGGTCATCCCGCATTTGAGCGTCCTGGCGGATAATCTAACATGACGCACAGAACGTGAGTTTTGTCTAAGCTGAAGGGAAGTAATGCACTCTTACT
CAACACCTTATCAATTTGTTGCCCTAGAGGGCAATTCTAGGCAGCAACAAATGAAAATCGTCAGTTTTGGTCACGATACTTAGCCACGGCACCAGGATAT
AGTACCTTTAGCACGTCGTTTTTACTCTCTCTCAGCTTTTGGAAGTGCAGGCGAGTCGAAATCCGAGCTACTGGGGTACTTTCAGTCTGCAGCGTCGACT
CCGTGGTTGAAAAAACTTTAGCACATTTCGCATCCTATCGTGCAGGGAACATAATTTAGTTTCAAGATCTCACACGGGTTCTCGTGCTTCACGCACCAAA
TATTCCTGTGCGCGTTGGGCTTCAAGGCGATTTCGTCGCTCTTGCTCCATCACGCGCATGCAAATCTTGTCATGGAAGCGCTTTAACTCGTTCGACTGGG
TACGTAAGCGAACTTCGGCCTCTTGGCGCTTCGATTCCGTTTCAGCCTGTGCAGATGCGGTGAGATTGACTTCGAGACGAAGCACTGGGAGACCCAAAGC
ACAGGTGAGCACTGGTTACCTCCACATCCACAATACCGAGATCGAGCCAGTCGGAATCCTCGTCTCCATCTAGAAGTGAATACGCTTCAGAGCCACCCCT
GTACAAACTAGTAAAGACGTTAATGAAATTCTTACAAAAATATCGTTCAGATGGTATGTCACGCACTCGTAGGCAAATCGCGAAGAGGGACTTGAACCGT
GTTCACTACCGACGGCAACGTAGGCTTACAAGTTTTAAGCGTAGGTAGTGAGTGTCCTAAGCAGGATTACGGTGGTAATTGGAACGCAAATCGAAGCTTA
CATTGAATGTCGTCGCCAAGTTCGTTCATCTGGACGACTGATCTATCCTCATGAAAAGACGCACTCCAAAAACCAAGTCAATTCCGTGAAAGGACGCAGA
GCGAAATTGGATACAAGTGAGCACCATGCCATTGACTCAGTACTATCATGTGCGCGATCCGATGGAGAATTTGCTCATCAGTGTGACGCTGCGCAAGGTC
GGTAAGCACTACTTGTTGCAACACGAAGTGAGGGTGACAATATGCGTCACTCATGCCGAATTTGAGTAGATTTCCGGGTTTGGAGGCGATGCAAGTGGAG
ATTCTGTGTCTGTGGGAAGAACATGGAGATATTGCTTCCGGTGGCAAGAAAAGAAGCTGAGCATGAGGTGCGTCAGAGAACGTGAATGTACTTTGAATTT
GTTGCAAAACCTCACACGCTTATTATGTTTTCTCATGATTTCCAGCGAAAAAAAGCGCGAGCAAGAGCGTCTGGAAGCGCGAGGCATTCAACTATCGAAT
CGAAAGGTTTGTATAACTTCCAGCGTATACAAGAGATGCAAAAACATCTAACGTATCGTTTTTGTTCTTCAGCGTGGGGATGGAAAATCGCCCGACGTCG
ACAACGCCGACATTTTGTCATCGTATGTTGATGTTGATGACTTTATTCCAAAAGAGGTAGAGATCGTTTGTTCATTGCTACCATTTCGTTCCTACACAAG
AGCTAACTGCAATTCTAGCACGTCAAGGACCTTCCGAGCACTTCAAAAGACTCCACGCACCTGATCCCACCAGACCTCGCCCGACGGCCGCGTGATAAAC
GAAATGAATCCGTATGGACGCCAAACCAGCATCGAGCGTGGCTGCGAGCCAACCGCGAGGATAAATTTCGAGCGATGCACATCGTTGCTCTCATCGAAGG
CAAGGAACGCGTTCTCTGCTCGTTGCGATTTTACAAGGAAAGCGGGTTATTCTGTGCCACACCAGGGTTTTCAGCGCCGATAATTGAGCCTGAAAACGAC
CCAGACCTGCTCATCAAGGGGCCTAAACTCACCACGTACCATGTATCTACTCCGTCGGGCTCACTTTACGAGTATGTTCTTGACAACGCACACGACCTGC
TGCCTTTTGCGTCTACTGAAGACCAATGGCTTTCTCGAGAAATTCGATTGCAAGAAGAAAAACGCGACACAGCGGAGGTGACGCGGTGGCAGCAACTTGA
CAAGCCCAGATTCACTACCAGCAATACCATGCAGCGAAAACTGATGCTATCGCTCGAAGTGGTAGCTGCGGATAATCCTCAGACGGCGGACCCGGTAACG
GTGGAGTATGAGCTCGAGTTGCCTGACCGCGCAGGGTGCTCAAAGTGGAAACTGCTGTCAGGAAATCAGAGTCAAACGCGAGGGAAGACGTCATTGTCGC
TACCCCAGCGATCACAATATCCCGACTGCGTTTCTTCCGCAGCGTTTGGAAGTCACCAGCACTTCAGCCTAAAACTAGTCAAAGCGGAACATTCGCTTGA
GGCCGGCAACGATCACGACTTTGGTGGTATTGTAGCCGCCCCAGTCCTTCACCTAAGCGTATTTTCGAGGGATTCGTGGAGGAGGAAGCGCACGGAAGGC
CATGGAGAGATTAAGCTGCCAGCGTCATCCGGCCTTCACGATTTTGATGTGCCTATCCGAAAGCCAATCGTCTCAATTCAAGAGCGGATGGAGGAGCTCT
TTCTGGGAATCGATGAAAGTGATATTGACCAAGGCTGGCCCGGGGAGCGAACTCGCGACCGAGAAGTCGGCGCTGATGATTCACCAATCTCCACGATGAT
CACCAGCCGACTGGGGCAGAAATCTGAAGCCACTGGCACGACGGTGAGGATTCGCTGCAACATTGTTGACATACGACCAGCAACTCGTGCCGGAGGGAAC
AACTCCGCAAGTTTAACGCCAGCGGTCATCGCTACGCCTTTGGCCAACACTCGTGTTGTAAAGCGAAGCGTGCAGGAAATTCTGCAATCCGTAAAACTCG
AGAAGCGCATAGCCAGCATAACAGACCCTCGTATTCAAGTAGCACTGCGCTCATTGCAATCGAGTGGAGTGGCAGCAACAACAGAATCACTAATATAATA
GGTCAAAGCGCGTTGGTATAGTAGCGCTAAAGTAGCACGTGTATTACGAGATTTGGATCAAGAAACCCAACGTGCTCAATCATCGTCGCTGTCTAGATCA
TCGAGTGGGTTGCCACTGCGCTTCTTCATGACGCGGAAGAATTCCTCCTCGTTGATGAGTCCGTCTCCGTCGCGGTCGGCCTCGTCGATCATTTCTTGCA
TTTCTTCGTCCGTCAGCGTTTCCCCCAGCTCGGTACACACACGCTTCAAGTTGCGGAAGGAGATCTTGCCCGTGTTGTCGTCGTCGAAGAGCTGGAAGAT
CTTCATGATCTCCTCGCGCGAGTCACGCGAATTCTACAGAGAATCAAAAACCACCATGAGAAATGAATCAACCCATTTGCATCAACACACAGGCAGACAA
CGTACCATTTTGCCCGTCATCATCTCGATGAACTCGTCCAGGTTAATGGCGCCGGACTCGTCCTTGTCGATGTCGGCGATCATCTGCCGGATCTCCGCCT
TCTTGACCTGGAAGCCCAGCGCCCGCATGGCAGCCTTCAGCTCTCGCACGTCAATGGTGCCGCTGCCGTCCGTGTCAAAGAGGTGGAACGCCTCCTTGAT
CTCCTCCAGATCCTCCTCGTCCAGCGCCTTCTTGACCGGCTTGGGCTTGCGTCGCAGCGCGGCGCGGGACCGCGCGAAGGCCGAAGCGGACATGGCACTC
GACTACAACAAACGATTAGTCCATGTATCAACACGCAGCATCTTCCAGCTCCCCACAAACTCCCTACAACGCACCATATCTCTCCTGCAGTGTTGCTCTC
GAGCTCGAAGCTGAATGGCAACGTGTCCGTTGCCCTGCTCCGCGACCTTTCGTATCGTCCACTTCAAGATGTACCAAAACAACGGTACACATCTTAGCTC
TAATTCTGATGGTGCTTATTTCGGGGTTCGACTCGTCTCATCCTGTTGTGGCTGGAGTCTCTCACTCTTCAATTGACCAGCAACAGCGCGCACTTCCCCA
CCCGCTAACTTTCCGCCCCCACTCTATTATAGAACGATGCTGGCGGCCGCGGCGAAGCGCATGCAGCAGAGCACGCTGCACACGCTCAAGGCCTACGACA
AGAGCGAGCACCGGCTGCTGGTCGTGGGCGGCAACGGCTTCGTGGGCAGCAACATCCTGCAGCGCGCCGTGCAGAAGGGCATCGAGGTGCGCAGCCTCAA
CCCGTCGGGCAAGCCGCAGTGGCAGGACGTGCCCTGGATCGACCAGGTGGACTGGCACGAGGGCGACGTCTTCGACGACAAGCAGCTGGCCAAGGCCGTC
GAGGGCGTCACGGGCGTCAGTGCGTGCTGTCGACCTTCCTGCCTGTAGGCCTGCGTCGATGTATTGACTAACTCTGCTGTTATTATTTGGTATTCCCGCT
GCTGCAGTCTCGACGGTGGGCGCGTTCGGCAGCAACGAGTTCATGGAGAAGCTGTGCGGCGACGCGACGATTGTGGCGGCGCGCGCGGCGCAGAAGGCGG
GCGTGGAGCGCTTCGTGTTCGTGTCCAACTCCCGCGTGGGCTCGTACTACCCGTCGTGGCTGCCCATGTACGGCTACTACCATGGGAAGGAGAGGGCGGA
AGCCGCTGTGCAGGCCAGGTGAGTGCCGGGGGAGGTTGGAGACGTTGGTGTCGTGTCTTGATGCTGAACAGTGGAGTCGCTGTGAGCAGGTTCCCCGAGA
CGGGTGTGGCGCTGCGCCCGGGCTTCATTTATGGCTGGCGCCGCACGAAGAAGGGTCAAGGCATCCCGCTGCAGCTTGTCGGCGCGCCGATCTCGATGCT
GGCGCGCGACCTTGGCGCGGCCTCCACTGCGCTAGGCTATGTGCCGTTCTTTGGTGAAGAGATGAAAGCTGCTATTCCTGTCGGCGCAGTCGCCAAGGCT
GCAGTGCTCAGCGCAATTGGACCGGTTCATGGACAGACGCTGGACACGACGAGCATGCTCGAGATCGCCGCCTCGTTCCACGTCCATGAATGAACAAGAG