Description :
From Genome Similarity Track
Location :
scaffold_61:69734- 70807
Transcript NameFunction/comments
g2456.t1 phosphoribosylglycinamide synthetase, putative

Sequence
1073 bases(100 bases per row)
TCCACCACGACGCTGATCTGCTTGTGGTTCCAGGCGGCCGTGCGCACGAACGAGTAGGCGCCAGAGACCCACTGGGCCACGCGCGTGTGTGCCGCAGCGC
CGACGTCCGAAGCACTGGGCGGCAAAGCGAGAACAGCTTCCACGCGGTCCGAGAGCATGAGCTGCACGTCGGCGGGCGTGGCCACGGCCACATGAGGCAC
CTTGGCGGCCACTAGAGCGGACTCCACGGCCGGCGAGCAGAGCGAGGCCACGCGCAGGCCGCCGGACTGCAGAGCCGCCGCGGTCTGCACCAGCGCATCG
GGCGCGCGGTCGCCGCACAGCACCACGAGCGGCGTCGATGGAGCCATTGAGAAGGAGGAGCTGGAGTCTCTCGCTTGGACGCGGGCGATTCGGGTATGGC
TGGCCAAGACAAGAGCTGTCTGTGGCCTGCAGGTGGATGGCTAACAACACGGCAAATTACAAGGAGCGCTTTTGCACCAATAGTAGAGCTTTATACGAGA
AAATGGACCAATTAGAAGCTAGATTGAAACAGCTGGCAGAAACGTAGTTGGATAAGCGATGAAATGGTGTGGAGGTTGAAGCGGCAAATTGGATGGGGAA
ATGCAAATGGTAGTGACAGGGTTCGAACTGCAAAGGAATGCTATTCCGGAAGAGTCTACATGGCGCAGGAGTTCTGTGTCAACGTATTGCTGCTGCGGAG
TCCAAGCGCGGTGCCAGCAACACGTGGAAATCGCTGGCCCAGCGGAACGTTGTGTATTGCACACTATTTTTGGTGTGCGCCACACGCTAGTTGAAGTCGA
ACCAGAAGTTCTTGTCCAGAACCTGCATTGCCGTCGGCGATAGTTAAGCTGGCCTCTCTCGTATATTCATGCTTGGATAGCGACTCACCATTGGTGAGAG
ACTGAAGACATTTTCCTGAGGCCTTAATCGCTAGCAAAGTGGATCCTGACTCGGGCGTTCGTCTCAAAGATGAACCATTTGACTGGTGGCTGACTCGGAG
GTCTAATGTGAAAGCGTTCCCTCGGAGGGATAAATGGTGACAGTACCGTAGAAGTGAGGCATTGTCTCCCGCT