Description :
From Genome Similarity Track
Location :
Scaffold_304:6973- 12022
Transcript NameFunction/comments
Phyci_450527Hypothetical protein
Phyci_99241Hypothetical protein

Sequence
5049 bases(100 bases per row)
GAAGCTTTGCTGCGACAATATTGTCGTCGCTATAGAGAAACTTTCCAACAATCGACTTATCAAGAAGGAGCGACGATTTTCCCGTGAACAGAACGCCTTC
AGAGAAGTGGCAAAGCTAAACGGCCTCCAGTTTGTACCGTTGCGTGATCGACAACTGCCTCAGAATTATTTGGTAAATTCCGAGGAAGATTGCCCAGGAG
AAGGAAGCACACACGTGGAAAAGTGGCTGGCCCCGGAGCGCAGGAACGGTGAGTTGGCGCCTGGACCGCCCTCCTTGGCGTCGGATATTTACAGCTTTGG
TACGATCATTGCTGAAGCATTGGCTCGTGGATTTACAGCAAGTTTTGAGGGCCTGGATGACGGAGATCTGCTCAGCGAATCGAGCCTACCTGCACAACTA
GGACATGACGCATGTGAGCTTGTGAGGAATATGTGTGCTCAGCAGCCGGAGTTGCGTCCAACTATTTCCCACGTCGTACAGCAGCTCGGATCTTTGGCAA
ATAGAGCGCAAGTCAGAGATCGGTCCGACAGCTACCATTCACGTGAAACTGAGGAACGGACGAGCTTAGGGAATGGTGCTCAATATTCTGACGCTGTAGG
CGACGGGATTGCAGTTGCGGATGTCATGCTTCCGACCGAAACAGAACCTTTGGCGATCTCCCAAGTGTTGGAGGCGTTGAATTCACGGATTCTCGAGCCC
GCTGATGGAGACATTGACGTTATTCCCAACGTTGAGGCGAGCAGTGGAAACGACTTAAACATGCAGATCTTATTGCGCCTTCAAGATATCTACGAGCGCC
TGTGCGCAGCCGAAGCATGTGCAGGTGAAGAAAGCGACCACACCGATAACAGCAGCTGCCTACCGAATATCGTATCCGACTTCGCGGAAGTGCTTACGCA
GTTTCGAGCGCACGTTAATGCTAGTCGCACTGGAAACCGCATCACACAGATCGCAGCAATTCGCCAGCGTGCTTCGGATAAATTCTCGTTCCACAAGGAA
CTCGACGACTTACTGGACAGACTTCGCGTGTATCGAGCGTTTTCGGTGACGGAGACTTCGCAGATCCACGACTGGAAGTGGCAATGGTACGCTAAGCGCG
CCCGACAAACTGAATGCTTCGAATGGACGCTGATTAAACCAGAAGCTTTCGAAATGCTGCTTGACGAGCTGAAGGATGCCCGCGATCGCGAAGAGATGTT
GGCATTCTTGCGCTTTGAAGTCACGCGTCACCGCTCGAGTTACACGCCAGCTCAAGTCGAAGCCATCGGCACTGCATGCACTGACATTTCTCGTCGATTG
TCCGACGCTACCGCAGTGTTCGAAGATGATGGACATTCAGGTGGTGCCCACTTTCACCTCTGGCGCCCGCCGAAGTGGTTTATCCCGCCTTACGAAGTTG
AGTTCGACCCCCACGAGTCCCTGGGCCACGGTGCCTTCGCTTCGGTTCATATGGGGAAGTGGCTCGGTACGCCAGTTGTCATCAAGAAGCTCGTACCTGT
GCAAAGCGATCTCACTGCAGCGAAAACCAATTCGGAACCCCAGTCGagcgtcgtgttctaccgggagctgagtatctggtaccgactcaaccacccttac
gtggtcaaactctacgggggttgccacgtcggcggccagccttttttcgtgtgtgaacatgcaagcaacggaCGTCTGGACGTGTATCTCCATCGATTCG
AGTTCAGAGGCGAGGTTAGTGGCAGCGCCGGCAACTACAGCAGAGACCGATCAACCTCCACGACCAGCGGGAATGCCAGTGGCTTCAGCCGGAGCACGTC
GAACACGTCAAGTACTGGGTATTCCGTGGAGAGTGCGGCCAGCTACCGGCGCTGCGAAGCCTGGCAGAAGTTGCGTCAGACCGCGCTCGGGTTGCAGTAT
CTCCACCAGCACAGCATCGttcacggcgatctcaagtgcgacaacatcctcgtggctgctgacgggacggccaagctcacagacttcggactcagcACGA
TTCGCCGCTACGTCGCCAGCGAACAGGAACGCGGCACTGCTTCAACTATAGTAGGCGCACAGAGGTGGAAGGCTCCGGAGTGTTTAGCTGGTGGCCCACC
CAGCTTCGAGTCCGACGTGTTCTCGTTCGGGATGTGCGTGCTGCAGGCTGTGAGCGGCGAGTTCCCGTGGGGCTCGCGCATGCCCGACGCAGCCGTTCGC
TTCCACGTCCGACGTGGCGTGCTGCCTCCGAGACCCAAGGGCTTCGAGGACGACGCGCACTGGGACCTCATCCGGCAAATGTGCTGCTTCGACCCTCAGC
AGCGCCTCAAGCTCCCGGTGGTCGTGCAACGACTCACTCGCTTCGCAGACCTGGAGGCGCGACGACAACGCGGAGGGGTTGGCCTGCACATGCGCGAACT
ATTGTTCGGAGGCTCCGTCACGAGCTAGTCGACGTCGACTGCAGCTACTGAAGGAGTATCAATGGTAAGGTGTTTCATATCAACCGGTGGCGAGATTCGA
CTCAGTTCATCCAGCAGCGCGACGCCGGTAGCCGGGTGAAGGTCAGCGAGAAAGCGACACCATTACCAGGCCAGCGATTCCGCCTCTCCGGTCCGCGGCA
TCGCCCGTATCATAATACGGCGAGTCAATCGTTGCCATGTGAACGAACATCATCAGAGCCGGGCTGCCTTCGAAGACCACATGGATGTGTCACGGCGACA
ACGCGGCAGGGTCGGGGAGCAAATCCCCAGTCCTTTGCGGCTCTCGACCCGCTCGAGTGGACAAATCGAGGCTTCCACATATTGGCCGTGCGATGGGACC
GAGGCCGCGCCGTCGCCGTCGCCATCACCGTCCTACCAACGCAGAAAACAGTGATGGCATGCATTGCTAACTCCATGGTGCTCTACTGTGGCACCACATC
AATCGCATCGTCTGAGCTGTTGCCTACGCTGCCTGAACGCCATACGCTGCTCTCTGGGCAGCTGGCACCACAACGTCGTCGGCAGGTGGTACTGTTAATA
CACTTGGCTGGGTGGCGTGGTCTCACTTGAGGAGGGATCGACATGGTGTATCGCCAGTATGGTGTTCGAACACTGCACCGTTTTGATGTTTGACGACCAG
CGCGCTTGATTCTCCACGTCCGCGAACCTATCTGCCATGTTGACATAGTGCCAGCCTCTGCAAGGAGCAAACTGCATCGAATTTCCATCTCGCGATGTGT
CTTCGTTCCGCCCCAGGCTTTGCGTGGCTGAGCCCAACGGTGCATGTGAACATGTATTTGCCAGCGCAATGGGTCGAGCATTGCTCCGCGGCGCGGTTTT
CTCGCCTCCCAGATGGGCTCGCCGATCGCGGTGGCCGATCACCGGCGTGCAGAAGCGAGTCGCAGCGTAGCGCGCATTGTGCACGGCATCGCCCAGCCGC
AAGGCCCCTACATCTGACTCTCCTCCTGCTGGCCCTGGGGCTCAGTGCCACATTCGCCCACTAGACCAATTCCGCCAACACGACAGCGTTGCGGCGGGGA
CGGACGTGATCGAGCGATAGGAGAGTCTCGCTTGACTCAAGACAGGAACGCAGCCCACCCGACTTGATCGCGATTAGCTGGGACGCAGGACTAGCAGGCT
CTCGACCACAGTACAGCAGCAGCAGGTTCACGCGGAATTCGGAGCGCGAGTGGCGAATTTCTACGCCGGGACCATGCAAGTCCACCGCCGCTGGCTCAAG
CTGGCGCTCGTCGCGGTCGCGTTGATGCACGCGGTCGCGGACGCGCAGGTGTACACGATGGAGAGCAACTTGGACGGCTCCGACTCGGATTCGGGCTCGG
ACCCGACCGTGATACGCACCCCGACGCCCACGGCCAAGCGGCCGACGCGGACGTGGATCCCCATCACGGACGCGCCCTCGGACTCCTCGGAGACGACCGA
CACGCCGGCGACGACGAAGAAGCCGCGCGCTACGACAAAAACCCCGCGGACAACGCCGCCGGTGACCAGCGACGACAGCGAAACGGGGTTGTCTGATAGC
TCTGGGACGACCCAGAAGAAGTCGTCCGACTCGGAGTCCACGACCGAATCGGCACTGGAGTCTACGGACGAGTCTGGGTCGGACGAAGCGGCCGAGTCCA
CGGACGCATCGGGGGCCTCGACCACCACCAAGAAGAAGAAGAAGAAGATCTTCACCAGGTCGCCGTACCTCCAGCAGACGACGCCCGTGCCCGATGGAAT
CCCTACTGCTGATGACAGCAACTCGGGCGAGTCGGCATCGACCACCGAGTCCAACTCGGAGGACTCCTCGGCGTCCTCCAAGACGTCCAAGTCCAAGACG
TCCAAGTCGACGAAGACCAAGAAGAACTCGTCGGACTCTACCTCGGGCTCGGACTCGTCGGCAGCCTCGAGCAAGAAGACCTCGAAGTCGAAGTCGTCCA
ACTCGACCAAGCAGAGCTCGGACGCTGGAACTTCAGGCACCGACCAGGCCAACCAAACCGACCAGACGGATGGCGCCACCACGACCCCCTCGTCGGGCTC
GTCGACGAATTCATCGTCGGCTTCAGGGTCGTCGTCCGCTGCCTCTGTCATGGCGGACTCGGCGAACTCCAGCAAGCCGAGAACGAACACGCTAATGCTC
GGCCTCATGATGGGAGGCGCCGTGGCGCTCGTGATGCTCGTGGCCGTGTTCGTCTACATCAAGACGTCCAACAAGGACGAGGAAGACGACGACATGGACC
CCGGTTTCCGCACGGCGCGCCACGACATGAGCAAGGGGACGGCCCAGACGTCCACGCTGAACGCCAACTACCACGAGAACGACAATATGTCCCCCATGCA
GCAGTACAGTGACGACGACTACTACCCCAACAACCAGCAGCAGCACAGCGGCCAGTACGACCAGGACCCGTACGGACACCCCGGCCAGGGCCACTCGGGC
CAGTACAACGACGACTACCTGACTCCGCAGAGTCAGATCGAGCTCGCGCACTCGGGCGCGTCGCTGCCACCCATGGCGCAGACCAACTACAGCCACGGCG
ACAGCCAGTACTCGCAGTACTCGGCGGGCGAGTCGTCGTTCTACAGCCA