Description :
From Genome Similarity Track
Location :
Scaffold_343:6972- 8079
Transcript NameFunction/comments
Phymu_g8850hypothetical protein

Sequence
1107 bases(100 bases per row)
TAAGTCAATGCTCCAGCTGGTATCAAAGTTCTGGCTAGGCTGCGCCGTGAGGCTAattgcagatgctgctgtttgcACATTCGACACAACCGTAATCAGG
GTCTCCTTGCAGCGAGACTGATCGTAGCCACCTTCATCGCGGCGAGAGGGcgtgttgttgttgccgttgttgttgttgcgatTTCGCGAAGCTTGGGCTC
AATACTTCTCTTGAGTTCGTCATACCGGATATACTTCCGCACGCCTTTCCAAACGCGAAGGTCGTCCTTCCAAGTCTTCGGCAACGAGTGGAACAGGTAT
AGGGACTTCTGTCCGTCAGTCGAGGGGGACTCGGTCGCTTCAGACGCGGCTTTCATCGAGTTTTCCAACTAAAAGAAGGTGTTGATCTGACCAGCTTCTT
TGTACTTGATCTCCATAAGGAAATGCAGGATGAAGTAGGGGTCGTTATGAAAGGCCGCACCCTTATACTTGGCACAGACGGCCTGGAAGTTATCGAAGGC
CGTCGTCAGATTCTTAACAAGACCGATATGAGTATAatccatcgtcttcataAGGAAAGCCTTGGTTTGGGCCTCCATacggcgaagctggcgagcAGAC
GGTAGGATAGCTTTGCGTTCCTGGACTTGCTTGCGACCACGCCCTGCGTAGCGTTCAGCGAATGAGCGAACAATAGGTAGATCACACCCCTTCGCTTTCT
TGGGTGGCGGGCTATCTTCGCCCTCGTTGCTGAGCTGTAACCTATCCGGGCTGTCTTCAAAGTCCACCTCGCCCGAGTCACTACTTGCAGGCGATCTTGG
TTTGGATGCTCGTTCATTGCCAGAGTCGgccaggtcgtcgtcgagtcttcatcttcactgaCCCCGTTGTAATCCTTATTGATGACGAAACCGAGCAGAT
GCTTGCTATCGAGTGAAGCACTGACTCGGGCCTTCCACACGTTGAAATTTCTCGCTCCGAAGAGTCGGGGAAAGTTGTCACCGGAGGCTGACTGAGGGCT
CATAACCTGCGCGGGCGCTTGTAGAAGAAAGCAATTGTAGGAAtaagtaaaaaaaaaacgagaAGTGAGATTAAAGTTTACGAAAGTAGCAGGCTACTAA
CAAGAAA