Description :
From Genome Similarity Track
Location :
scaffold_850:6972- 8076
Transcript NameFunction/comments
Pl_102138hypothetical protein PHYSODRAFT_252207

Sequence
1104 bases(100 bases per row)
ACCGGGGTACAAGCCGAGGAAACCTGGGGTTGGCTCGCCCTGCACCTCACCGAAGTACAATGTGAACGTCTGCTTCAATTCCTCCACCTTCTTGCGGTCC
TCCATGAACAGCGGGAAGCCAGCCATGTTGGCCTCCGGGATATCCCAAGGTTTGTCCGTGTTGATGTCTGTGCGCACACTCGGCGCCACTGTCGTCGACT
GCACCTCATCCGACAGAGCCCAGTTCATGAACAATTTTGCGGCAGCTGGGTGCTTGGCCTTAGCCAAAATGGCAGCACGCTGATCCCACGCGATGTACTC
GGTGTTGTTGCCAACCTCAACGTTGGTACTAATGTCGGTGCCCATACCTATCACCTCCTCTCCAGCAGCTACCCGTTCCGCTGCAACGTTCGACCCACGG
TGGAAAGCGATACTTTGGTTAGCCAGCTTGGCCACCCAATCCCAACCGTACAGCTCAACGTATCGAGTGTACAGATAGAGCACAGCATCGTCGTCGTTGG
GGTAAGACGAGGCGATCTTGCCAGCCCATTGCGAATCCGTCAGGTTTTCCAGTGAAAGAGGTGCAGCGAGTCCATCAAGACTAGTAACGTTGTAGCTCGT
GTAGAAAGAGTAGATGGTGTATGCCGTCCAAGCACCGTCATTGTCCTTCAATGATGCGTGAATGTTGGAGAACCCCTTCGGCTTGTATTGGAGAAGTTTG
CCTTCGTCTGCCCAGCGAGTGTAGTCCTGTAGAGTCTGCAGCGCTACTACATCGGGCACCAGCGTATCAGTCTCCAGCTGGTTGTCAATACGCACGTCGT
GGTACTTGCTGTAGTCGACGACTAGCGTGAAGTTAATTTCTGGGAATCGCTCTTCGAAAGCGTCGCGCAGACTGTCCTGCTGAGTGGGCGTGTCACCTCC
GTGATACAATACGAGCTTGCCTCCTTCAGCTACAGCCTCAGCGTAAAGGTCGTCAATGGACTTGGTCTCCTCCTGGACCTTGCCCAATGCACTGGATGAA
AGCAGGGCAAAAGTAATAACAAGCGGAGTGAAGAGCTGCATGGAGTTTCTTGGGTTTAAGACGGATAGAGCGAATTCGAGAATGACAACCGATTAACGAG
GCGC