Description :
From Genome Similarity Track
Location :
Scaffold_271:6972- 8027
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_271-snap-gene-0.10Gene of unknown function

Sequence
1055 bases(100 bases per row)
GCTGCGTCCACACTTGCGCTCATGGCTCCGTCTGAAGATGGCCTCCAGGATGGTGCTGATTTGCTCAGCATGCGTCCCAGTAGCTCTCTTCAATCACGCG
GCTGCAGCAGGCGATGGCACGCCATGCAGCGCTTCAAGACGCGAGGTCTCCTTCCGCCAGGCCCACCAGCAGCGAAGCCTCAGTCGAAGCCACGCCGCGA
TTGCTACCTCCACCACCATCACCCCCGCAAGAAGAGGCCAAATCCACACGATGGGAGGCTCATGGAGAATCCAACGATACCAATATGACGACCGCAACGC
CATCATCTGTTGCGGCGCTTGCTGAGCAACTGCAGAACCTCTGGCGACCAAAGTACACCCAAGAGCAGACAAGAAAGTCGCAACCAAGACGAAACATGCA
TGCCGATGTAACGGAAGGTAACGACGATGATACTGGCGAAGTTGTCGATCGCCAAAGGACAGCACGTGTTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCATCTGCTGCAGCAGGTGGACGTGTACCGCACGCAACTGGACGAAGTGGCGACGCTGGGCGAGACCA
TCGCGGCCCAACTCGTGCACCAACAGGTAAAGTGCCTCCTCTGCTCCATTCACGCCTTCATATCCTCTTTGACACCTTGCTTGCTCCTGTGATGTATGGT
ACATGTCTTTGCTCAGCACGAGCTTCGAGTGAAGCACCGCGAGCAAATCGCGAGTCTCGAGAAGCAGGTGCATGACGCCGTGTACCTCCACCCGCGCGTC
GCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCAAGTCGAGACGCTCGAGGCCAGCAACCACGACAAAGACAAGAAGCTCCACTTTGCGGTCC
AGAAGCTTCAGCGTAGCCGGAAACGCGAGAAAGAGCTCCAGTCGATGCAGGACCCGCTGTGGGATATCTAGAATAGAAGGGTACAAGACGTCTACGCATC
AGGGGAGACACACAGTGGGGAAAATACAAAAGCGAACATGTTCTTTTCGGGAAAA