Description :
From Genome Similarity Track
Location :
contig_29:697172- 699185
Transcript NameFunction/comments
g6917.t1RAW23941.1 hypothetical protein PC110_g19626 [Phytophthora cactorum

Sequence
2013 bases(100 bases per row)
CCATCCCCACCAACAATTGGTGGGGCAACATGATCGCGCACGACTCCAATGCCGCCATCCAGCCCATTTGGTCCAACCCGTACTCGCTGCAGATGGTCGC
CGACAAGGCTCCGTTCGGCATGTCCGTCAGTACCCGTACGCAGTCGCTTCAGCGGAGGCAGCTCCGGCAACAACGGCGCCGTCAAGTACTACGCGCACGG
CATGGTTCGCGAGTTCCTGTTCTCGGCCGAGGAGATCGTGTGGCAGAAGCCGAACTTCCAGGTCGTGGACTGGGCCGACCAGGGCGTGACCGTCAAGTTC
GCTGCCAGCTCTTCCAGTGGCAGTATGGTGTCGGACCTGGTCTCCGGAATGGTCTACGCCTCCACCAAGTACTCGGGCCTCACTCCGCGACTTGTGTCGA
GCGCGGTGATCTCCAGTGTTAACGGCCAGTCGCTCGGTGGTCAAGTGCGTGGCTCCAAGTTCGAGATCGTCTACAACTCCGGCCAGAAGTGGGTCGTCTA
CGCGCTGTCGAGTGACGGCCGCAGCGAGAAGGAGATCACGCTGACGGCGGACGGCAACTCCGCTCTCAAGAGCACGGGCGTGTTCGACGGTGTGCTGCGC
GTCGCGCTCGTGCTCGACGACTCGTGGCTGAGCACTCTGGACAAGCACAAGTCCTGTATCGTGCAAGCGGCGAATGTTGATCTCCGTGACGACAGCTCGT
ACTCGTTCAAGTGGAAGACGGTGGGCGATTGCTCCGGCGGTCTCCTGCACTTCGCCATGAAGCACCATGTCGAGACGATTGACAAGAGCAACGGGGTCCG
TCAAGTGGACGGCATGGTGGCGTATTCGACAACCCGCGGGGCTTATCAAGCTTCTTGACGCCAGGCGGCTCAGCCGACCCGGTTTGGGAGATCAAGGAGA
CCCAGCAAGTTCCCGAGGACTTCTACCCAACGCGCAAGGTCGCATCCAGCGTGGCTCAGCAGCAGCGGATCGCCGACCACCTGCGCGAGGACATCAACGG
CGCCTGGTCCATTCCGCTCGACGGCAGCTACTACTTCAACGGCAAGGCTGCGCAGAAGTACGCGTCGCTGTGTCTGATTGCCAACGACGCCGCTGTCGCC
GGAGGAGACAAGAGTCTGCTGAGCACGTGCCTGAACAAGTTGCGCGGCGTGATGGCGCCGTTCGTGACCAACGCCTGGACCAACAAGCTCCAGTACGACC
AGATCTACGGCGGCATCGTCAGCTCGCAGGGCTTCAAGACCAAGGACCTGAACTCGGACTTCGGCAACACCATGTACAACGACCACCACTTCCACTACGG
CTACTGGGTGCACACGGCGGCCATCATGAACCGCCTGGACCCAAGCTGGAGCGACCTGGGCAAGCTCAACGCCATGGTCGACCTGCTGGTGCGCGACGTC
GCCAACTCCGACCCGGCCGACAAGTTCTTCGCGCGCTTCCGCTCCTTCGACTGGCTCCGCGGCCACTCGTACTCGCACGGCGTCACGCCGTTCGCCGATG
GCAAGGACCAGGAGAGCACGTCCGAGGACGTCAACTTCGCCTTCGCCATGTACATGTACGGCAAGGCCACCAAGAACGCCGCCATGGAGGCCGTGGGCAA
GCTCATGACGCGCGTCAACGCGCACGCCATCAAGACGTACTTCCTCATAGAGGACGCGAACCAGGTGCACCCGGCCAACTTCCGCCCCAACAAGGTCACG
GGCATCTTCTTCGACAACAAGGTGGACTACGCCACGTGGTTCAGCGCCGAGAAGTACTGCATCCACGGCATCCAGATGCTCCCCGTGTCGGCCGTCACCG
AGTTCGTGCGCACCAAGCAGTTCGTCAAGGAGGAGTGGGAGCAGGTGCTGGCCAAGGAGACCATCGTCACGCGCGAGGACACGAGCAACTCGTGGCTGTC
GCTGCTGTACATGAACTTCGCCATGGTGGACAAGCAGCGCGCGCTGGGCGTGCTCCAGAAGGCCAAGATGGACGACGGCCTCTCTCGCTCCTGGGCACTG
TACATGGCCGCCA