Description :
From Genome Similarity Track
Location :
contig_8:697- 3057
Transcript NameFunction/comments
g1550.t1Chloroperoxidase

Sequence
2360 bases(100 bases per row)
CAGCCCGATGCCCTAGCAAATACCACACCGTATCCTCATTTGGTGGAAGTTTCAGCTGGACGCAGTGAGTGAACCCTATTTGCCAGCCATCCCACCGCAA
GCACCAGTCGTACAACGCAGTCGTTGTCGCTCGGTCTGACTTAGCCATTCCTTTCTTCTTTAATGTCTTCTTTTCAACACCTAGCTCGTTCAAGAATTCC
TGCACCGATATAAGTTGGCCGGTAATCTGCACTCAGAAATCCCCTTTTCCCCCATCGCATACTTGTCCATCGCTAGAAGCAGCACAACGCGAGCAACCAT
CTCGCCATCTCCGCCAGTATCTAGCGTATCAACTTCTTGAGCTGAGGCAGAATATAATTTGACAGTGCGCCATCTTGTCCATACCACACTTTCATCGCGC
CAAGGTGAGCATTGGGTCTAATCCATAGTACTCAAGTACCCTCTTTCTCATAATTCACATATGCGAGAATCGCGATGAAGCCTACGATGACCCGTGACGT
CAACGCCGACGTCGAGTACGGACGCACATCCAGTCGACAGACCATTGACGCAACATATCCTCGTTGTAGCTGCCTTTCTCTTCTAGGTCGCATCTCAGTA
GCAGTTTGCTCGCTGCGAGACTAGGCTTTAGTTATTCCCCTGGCTCCATGTTCTACAGCTAGATCGGTGACCGTCATCTATGGCCCATTCATATCAGCGC
GGTCCAAGCCTCATTCATTCTCACTTCCGGTCAAGGTAGCCTTGTACGCGACGATATCTGCACTCCAATATTTGCAATCCTGGATTGTATTACCCACCCC
GACCTTATCGTCTGCCTTCGTCTCAGTTTCCAACAATTTCTCCATCCACCATCACTTCATCCAGCACTTCACTCATCGCTTCGTCACTATCTGCCGTGTT
TGTGCCATGTGTGCAATGCGTTCACCAAAGCACATCCATCGTGTGAGTAAGCACGAAAGGTGGGAATGCTGCTAGCTCCTTCCTTCGTACTTCCGAGATA
ATTGGTCCAACGATAGCGGCGGTACCAGGTCCGAAATCTTGGAGGGCGTATCCACCAGTATGCCAAAAATGCCACCTCCAGTGTTAATTTTATTGTTCGC
AAGAACGAGGGCCTGTTGCAGCAGATGAAAGTAGTTGCTGCTGTTGTGTTCGAGAGCAAGAAGGGACCTGGCTCTGTCTACGGCCAAGATCACCAGTGGC
GCACTCGGGCTCGCTGCGTCGTTTGGTTTCCCCTTCAACGTTTTTTCGGACGCCTTGAAATGTTCTGCTGCGGATTCGTTGGCTCTGGTGTCTGTGGATA
GATTCGTCCACTCGCTCAATGAATGCTCGTGCGCTTGACGATATATCGCCAGCAGACGATCTCCGATTGCAATATGAATAGATCCTTTTGCAAGCAACCA
ACTACGCAGCTCTTCTGTAGCCTCAGGATATCCCGTCGACTTGTGCAAGCGCGTCCATATGTACACAACTTTCAGCTTTGAGTCAGGATGTTGAACCTCT
CGTGCAAGCTCAAGAAGCATCCGAGTCTTCCCGAAGCTGGAGCTTTGTACGACCGCTACGTAAGGCGCCTTGAACGATTCTCTCTGCTTGCAGTACAGAT
CCCAGCACGTCCACAAGTATTTCTCGCATTCAACCCTGCATCGCCAACGTACTCGGTAGTCGTGAACGCAAACTCGATCCACTTCATCTCATCTTCGCAT
GGGTGGCTGCTGCCACCAACTTGGCCACTTCCATTGCATCGGCATGGGCGACTGAATATTGAAACACCATGGACGAGACAACTGATGCGTGGAGTATGTC
ATAAGTCTTGTCCACACAATGCTCCCCTGCCCACTCGTCAGTCAAGACCGCCTCTTCTCTTTAAGGTCGTACTTTGAAGCGAAAGGTTCCGACTGCAAGC
GCCTGGAAACCTCATTGTTCATGAACTTGGCCAGCGCCTTCGCTGTGGCCTCCTGGTTCAGCGTATCCTGCGACCACACAGCACAGCACAGCACAGACCA
TACTACTACCGCCACTACATGGAATCATCTGGGCTTGACGTACCTGTGCTGAGCTGCTAGGAGCGCTCTCAGTGTTCTCCATCGCCAGGGTTGTAAAACC
TGGGTTCTCTCTCCAACGCGAGGGATTGGACTGCGCAACACGGGCAAAAGGAGCTGGATAGTTATCGCTGGGGTACCACAGTGAAGGAGATATTTATCGG
TAGACTACCACAACGAGCGTTTGCCTCTACTATGAAGTCTAGTAGGGCCTTAGACTAATTCGGACTTTCAGAGCTCTATCAAGACTGGTCTGCTGGTATT
TAAGAGCTGGGCAGGTCAAAACAGACTTTAAAACCGATTTAGCCTCTTTTGCCAGAACGG