Description :
From Genome Similarity Track
Location :
Scaffold_1889:697- 2660
Transcript NameFunction/comments
Phyta_totarag13819hypothetical protein

Sequence
1963 bases(100 bases per row)
TCGTATCCTATGTGTCTTTGGCTTGGACGATCTGGCTCATTCTGTTGAATGTCGCGCCCAACGACACTGTGAACCGTGTCATGAACACGGAGACGTTCGA
CTACGGGTCGTTCTGGCTCATGGTTGACGCACCCGATGCGATTACGAGCATGGCAACGGTTGGTCTGTCGATGGTTGCAATCGGATACTTGGGTGTCGTC
GTCAAGATGATCAACTGTCGACGGAACGCGAAACATCAAGCGTCGGTCCATCAGTCCTCCACCAAGACAGATCTCCTCACGAAGGGAAAGACCGAGAGTG
CGTTGgatgcttcttcttctcaacGAACAGGGAGCAGAGTGTCCTCGGCCCTGAAATTGGCTACTTCTCTAACTCGCGAAGACAGTCCAGCCACAAAACT
CACTGTACGATTGGTTTACATGCACTACAAAGGCTTCAAGCACTTGTTGCGGTGGCTAATGATTTCGTTCTTGGGTGTGCTGGGTCTTGCAGAAACTCGG
CATGAAATTCGGCGACTTGGCGCTGGAAACTCTTCTCCTTGTTcagatgctggaggctgGCAGTCCGACCGTGCTTCTTGGGATATTCACGGCGGTCGTC
ACGTCCAACGCGCTCTCTTGTGCAGTCGTAATGTTCGTTCCGTACGAGCGTGCACCACTCGCTGAAATCCTCCTCGACATCCTGTAAGTTTTCTTGACTG
ACAGCGTACGATGAATCCGTCGCCTCTTCTTAACGGTTTGTGTCCTGTAGATTTGACTTCCTGATCATAGTCGGGTACCCTATGCTCGTGGTTTTCTATT
GCCTCTCtgccttctccttcgacCGCGCCAAGTTTGCTATCAATCTGGAGGTATTTCCCGCGGGTTGGTTTGAACAAGAAGCAAGCGTGATCGCGAACCC
CGAGGAGACTGCTGTCATCTACCAAAGCCTCAAGTCGCTACGTGTCATGTCGATCCTAAGTTTCTTGACGAGAATGAGTGTCAACATCACGCTCTGTCTA
CGACTACGGCACCTTGTGGGGCTCATACAAAACCCGAAAAGGCAACGGAACAGTGTGTACCCAAAGCAACAGCGTCTCGCTGCCGTTGTACTCgttgttt
ttgctgcggcTCTCGTAGTTTTCGTCGAAGAGAGTACGAGAACTTCCAGATTGGCGTGTCAACCGCATCCTGAGTGCGTAGTGAACGCGCACCGATGGCA
GCTTCAAAGTGACTCGTTACGACAGTGTCCGTGTTTGATGATGATTGATCGTGACATTGCTCCGAAGACGTTCACCGAATGGGACACTCCGAAGAATGTG
GCGGCGAAGGTGGCCCAGCTGGCTGCGACAGGAGACTTGCAGACGCTTCAAGTGACAAATCGATATTTGGCGGTGCTTCCAGACGAACTTCGACGATGCT
CAAATATGAGGCACATGTACGAACTTATCAACAGTTGACTGGCTGGCGGTAGTCAATGTAACTCACTTGTTTGTCATGCTGCCCAGAGCTTTGGTATACA
CCCAGACCGAGACGCTGCCTCCTTGGGTGAAAGAATTCACCAAACTCGAATTTCTGTAAGTCCCTGCGTGGGGTTGACGTGTGTCTGAGCCTGAGCCTGA
ACGTGGTCTTTTATTTGGTAGACACATTGAGAGCTGGCCGAAGGGTTCAATGCTCTCGCTACCTGACGACATGTTCGACGACATGTCGTCACTCACCTTC
ATCCACTTCTGCGGCTTTCTTTTTATGCCTCAGCTGCCATTGTTCAACTGGCTCACGAACCTCAAAACGCTAACGTTATCCGTCTTCATCTCCCGCAAAG
AACTTCCAGCGTTCGACAGCCTCCGCAATCTCGAGCGTCTAGTTCTGGTGAGTATGCCGTTTCTCGACACTCTGCCAGACTTCTCCTCGTTCAAGAACCT
CAAGTCTTTTGCCACACTGGATCGAGGCACTTGGTGCTGCAATGGGTTTCTCGGGGACTGCAA