Description :
From Genome Similarity Track
Location :
Scaffold_69:69692- 72354
Transcript NameFunction/comments
Phypa_INRA-310PPTG_17578hypothetical protein

Sequence
2662 bases(100 bases per row)
ATCGGGAATATGTATCTTGGTATTTACTATCCATTCCAAGCCCAGATAAAGTATGAGGTTCGAGGTAGAAGTTCCCCAGGCTCCTGGGTAAACCCCAGCT
AGCTGTCTAGTAAAATACAAACGTTTATCGAAGTAATCCGAGTGGACATTTTAATTTTCGCTAGTAACTCGAAAGTAATAATAGTTCCTCGATATAATAA
TCGACGAATCAAGTTTTTCGCATATTCAACAGGATTTGCCGCAAAAAAGGAGAGAGAGCTTCGGTGACGACAGAGAAAATAATCGCATCTAGTGTTCTAT
TGACTTGTAAATAAAACCCCTTCTGAAGCACTAGTTACATTTTCAATGGGTAAGGACCGGCAAATAGTTATTTGTCAGGTTTTCACCTTTTGGGCCTTTT
TCTCCAAATACGTTTACGTTGAATCAGTAGCTTCGGCTCGCTCCAGCTTCACACGCTCACTCAATGTCACGCGCTCAAGATACTCCTCGAATTTAGCAAG
TGATTTTTTCTTCGGTGACAAGCCATATTTCTCCTTCCGGAATCGTGCACGTTGCTCTTCGAACACTCGCAGAGCCTCACGCTCTTCTTGAACACGACGC
AGTTCATCACCATCGAGAAGCGTGTGTTCATGTTCTTCTCGCTTTCGATTCGTCCATTGTTCGTAGAAATCATCCAACAGCGTATAGTAAAGTGTCAAGT
TTTCCAGCTCACGCTGTTGTAGATAAGAGCGCTCTCGTTCTGTTCGTCGTTTCCCGTTAACCTGCTTGCGACGTCGGAGTTTATCCAGTTGCGTGGGTAA
CACTGTCACGAGGAACGGCATCTTCTCTCGGCTCTTACCATTGGTTGTAAACGGCAGATGTCGGTCTACAGTTTCGTCTTGATGTTGCAGATTTGAGAGA
TCTCGGAGGTCTTCATGGCGATGTCTCGAGCGTGTTTCATTCTGCATGAACGCTCCTTCGTACCAGAATTCCCACTTTTCCTTATACTCTCCAGTATCGT
CAGTCGATTCGTCATCAGCCCTGTTGTCATGAAGACGATAGTAAAAGTCTCCTCGGCCATCCATGGCGTCTTCGTGCCAAAATCCCACATGCTTAGATCG
TCCACCTTCAAACCGAGCCGTGCCACGTCCGTGGCGAGCGCCACCATCAAAGAATCCTTCATATTCATCACCATGACGTTCGCGTTGCCTACCACGTCCA
TGCGGCTGGCCTTCGGCAAATGGTCCTTCAACGAATGACCCATCTGGAAAAATTCGCTTGCAAACTGGGCCATGTAGAACTCCGTTTACAAATACGCCTT
CATCGATCACACCCGTTGAGCTGACGTATCGTCCTAGTCCGGAAATGACCCCGTCTCTCATTTCGCCGTCGTAGGTAGCGCCGTCAGGAAATATTACGTG
CATCTCGCCGCTCTCCGTACCGTCACGATAATCATCCCCATTCAGTAGTGAACATCCGTACGCACGACCTCGTAACTTGTCGTTGTATTCGTAGCGACGT
TGCGGACGATCGAACGTGCCTTCACAAGTTGTTCCCTTGCCGTATACAAGCTTTCCATTTCCACAGCGAGTGTTACCACTAAAGTTACCAGTATAAACGC
CAACATTCGTGTACTCTTGACCTTGGCCTTGTTTCCGACCAAGACGAAATGCTCCAGAGTACACACCGCCGATGGATGAAAAGTGAAAGCTCCCGTCGAT
AGGATCTAAAGGCACTTCCTCTTCATCAGCAGCTAACGCTGTGAGTGTAGGCGCCATCAATTCACCCTCTCCGTGTCGGAGTCGACGAAGTCTTACCGTT
CGCATGTTGATCTCCTTTAAAAGATCGTCAGGATCGATCATTTGGTTAGAAACTTGGTCATCTTCGAAGAATGCCCGCGGTTGAGGTCGCGTCTGTACAA
GGCAAACGTAGTTCCAGTCATTTTTACCCAGAGCTAGAGACGCAAGGTCACGTCCACGTGGACTCGTAAACGTTGCTGCCCAAGTCTTCGTCTCTACTTC
ATCCTTGATACTAGTCGATGGCAGCTCAGCATCCCGTGGAACTTCAGTGAGTGTTATGGGCTCCGTCATAATCAACTTCGTCATGCGTTTCCGTCGACGC
TCTAACTCATTGATTTCATCTGTTAGTTCCTTCACTTGGGCGTTCATAGCGTCAGCCAAATTTTTACGAGTTTCAGTCTGTTCTTGCTGAGTCCCAGCAA
GGTCCAAGACTGGTAGAGCGTTGATCTTCTCCTTCAAGACTTTCAACTTCTGACGTGATGTTGCCACTAAAGGTTTTAGTCGAAGCAACGGTTTGAATTC
TTGAGTGATGCCAAAGAGTAGCCATACTCTGATGTCAACCGGTTCGCATTGAACTGGCACGAAAGCAAGTACCAGTAATGCTCCACCAGTGTACAGTGGG
TCTTGGAGATCATCCTGCGGTATTGGCTCTATGCGTTCGTGGATGATGTAGTACCATCGGTCGGTCCCGTTGGGTGGGAGTACCTGCGTCATCCAGTCCT
TGGGCCAAATCACATCTAGTTTTACGGCCTTAGAGTAAGTTGAATGGTTTGACTGAAATGATATACATTCTTTGTAAGCGTACTGTTAAACGGGTCCTTA
AGTAGAGCAGCGTTGCATTCAAAAAGCGCATTGATCTTGGGCCTGGACACGCAACATGGTAC