Description :
From Genome Similarity Track
Location :
Scaffold_57:69683- 74081
Sequence
4398 bases(100 bases per row)
CCGTTCTTCGTAATGATCACGACTATTGGTGACGCCAACGGCGATGTCAAAGGTCGATTAATCTTGGCTGACAACAACCCCTATATCAAATCGGCCAACT
TCTCACGAAATTTTGGCGCAACCGGTCGTACACGCTGCCCGATTCCCCTCGCTCAGCCAACATCGATATAGCAAACGGTCCCGCGTGCTGCAGGGAGAAA
CGCATTCGTTTTGTTAATCAACAAATGACAACTCTTCTACATCGGTTTTCTCAGATTCTTCGATCATCGTCTAATGGTATCCCATGATCGCCCACTTGGA
CATTGTCTATCATTCTCTCCATCGTAGAAGTTATCACCTCCGACAGTACAGCCATAAGTTGCTCTACATCTTCCGCTAACTAATAATTCTCTTCGTGATA
ATAAATTGATGCAGCTGAAGATTTCTCTTTCATCGTTTCCCCCTCAATCGCGGCAGCCTTCGCCGTTTCGACCTGTCGCTCGGACCGCCCATGTACTGCC
TGATCCTCGACCTTGATCCCGTCCGTCTGATAGCTGGACCGCCCTTGTAGTTAATCAGTGATCATATGATCGATCTCCTGTGATAAGGCCTCCTTAGCAA
CCCCGATTACTTCATTCGATCGTTCTGGGGTCCTCCACACTGCGTTGACCTCACAATTCCTTTGTCGATCTCCGATCCTTGCTTTTGCTAATCTTCCTTC
CGGTTTACTCGTCTAGAATCTCGTCATCAGTGTTACAGTCATGTTCAGATCGCGATGTGATCGCTCTAGAAACCTTGACGTCCTTTGATTCCTTCTTTGG
TCGGATGAAAATTCGGGTGGGTTTCTCTTACGCTGGATGATCAACCAGTGGTACCGCATATGCTATAATCTCTTATTCTTCTCGATCTAAGTTAGCTTAA
AATGCCAATGTTTGCCATTCCATATACCGCTGCGATCCAACAAATACATATCCCTGTGATCGCAGTATCATATCCGCTGTCATCCACAACGCTAGCGGAG
CCCTGTAATTTAAACACACATCGCGATTACATATATTCGTAAGCTGCAGAAACATTATCTTGCCAGTTTCATTTGTCACTGTTGGAACTCACGCCACATC
CCGCCTCACCCAAAGTTTGGACTTGGGAGGATTAACGCCGACCCTGACTTCAGTCAGTCTACCGGCAGGGATGACAATATGTTGATACTTGAAGTTGATC
GCCGATATTTTCGATCGGTATGGCGGTCTCCGCCCAGCCAAACAGATGTGAACTTTGGCCGTAAGACACAGGGTTCCGCAGGCCAAATCCAAACGGATGT
CTGCCGGAACTATGAAGCCCATACCCAGTATGGCTTTTTGACCAACTTGATCACCAACACATCGTCAAAAAGTATACTAGCGATCCGTCCAATGTGATTT
TGATCTTGGTCCTCCCTATCGTCATGTAGGCATTCTCCCCTATCCCAACAATTTCTCGCGTCTGGCTCTCGTCGATAACACATCGTACCTTACGGGCAAA
GGTTGTGTCGATAATCGGAATTCAGCACTATAGTCGAACAGCATTGTGAACTTTTCTTTATTGAATTTGCCCACTCATTTCGCTTGCTTGAACCGTTTTG
CCGGGGTGTGATACCCCCAGTATCCGCGTGATCCTTCTGGGGCGAGCTCGAGCTCCAACTTTACAGGAATACGAGCATATTCGTCCACTTATGTCACACT
TGATACGGAAGAGACACATGTAGAACGATCACGTATATTAGTGACCGGATAGCTCCAATTCTTAACACCTTGATCCTCTAATCGTCTTTCAACAAATGCA
CATATGCATAGCCTAGAACGCTCGGCTCGTGCCAGATTCCAAACTGGCGAGCTTCCTAGCTTCACATTTCCTTGGCCTTCAGAGAAAACATCCCAGCATG
CTTGGCGGGCACGTACCACTTGCTGACCAAGTTGTAGAATTCTTTCATGGGGCACTTTCCACCCTCATGCATCTCTCCACAAGCTTCACACACATAGAAA
CACTTTCCCGATGGATATCCCTTGCGACCGCATATCTGACACGTCAATTTCTGCCAGAATCCACAATCGTCGTGTTTCTATGATCCGCAATGAGTGCAGG
CTTTATTAACCGTGGCACGATCCGAACTGTAATCTTGACTATTCTTATCGGGTGCAGTACGTTGATCTACGATTGTCGTCGTGCGATCCGAGGTAGCGAC
CACTACCACATTTCGTAGTACTCTTTCAACGTCCGGTGCTCTGAGATCATAGTCTGAATAACTTTTACAATCCTCCACGAGAATGTCCCTCACAGGACGT
GCTAGTTTTGCTGGTGTTTAGGAACCGTGGGCGCAGATCGTGGTCAAAATTTATCCGATCACATAAATGCTTAAGCTTGTCGATTCTCCATGCGCTTGAA
AGCGCGTAAGGTCTCATACATCTTATCCGCCGCCCTGGTCCTTAACAGCATCAGTTGCTTGGTCAGGGTCCCAGTAAAATGTTCCACATGTTCACGACGT
ATGTCTGGGGATCCCCCTCGAATTCCTATCTTTGCTCTATTTGCTGCCACATCCAAACGATACGGATAGTTCAGAGGCATTACTTCCGGTCGCTTCTTGG
CCAGGTAATATTGTCTTCAAACAGACAAACCATTCTTTCCATAGTGCACGAGAAAACTTTTCAACAGGTCCTACCCTGAATGATGTGTGGATCGGCTTAG
CTGACTGTGCCAATTTTGCGCAGGACCTGTAAGCAGATTCTCAAAAACCAAGCACTTCTCCACATCTGGAGCCTGATAACGTAAGAACGCAGACTTGACC
TTGTCGATCCAGCTTGTGCCTCGATCTTCATCTTTGTCCTTTCCATTGAACTCGTTCAGTTCTGCGATCGCATACATCCAATTTTGCGTGGTGCGAAGTC
GACCACCTGGTGCGGTCTCCGCAGTTGCCGCGGGTGGTCGTCTCAACTTGTCTTGCCCGAAATCGTCAGAATCTCCTTCTTCACGGTAGTAGATGTCAGA
TCTACCGTGCTGAAATCCAAATGGTTTCATCTCAACATCAGGGGTGTATGTCTCGTGACCCTAGCAACCTTGATCCTCTGACTTAAGTATATCGCTTGGC
AGGCTTGGTTACTTTGTTCCTGCTGAAACGATTGCATGGCAGCATCAAAATATGATTGAATTTGTCCTTGGAGTATTCTAACCCGCATCTACTTAAGCGC
GTACTGGTGCAAATCGCGGTCCGCTCTCAGTCCTTTTCCTACGACCACGCAGATCGGGCCTCGTATCCATGCGATCGCGCAGATGGGCATCCCCACTTGG
ACCTAAAGACATCCGCTAAATGCCAATTGAGTCCCCTGATTCTACTCAGACTCAGCTGAGTCATTCTATGATGATTTAGTGTGATATCCTCTCCGCACTT
CCGCAGCCGTCGGTACCACGTGATCGTTCGCTGTTGTCGGTTGCACATGGTCTTTGAAGCTACGTTTTGCCCATCAATAAGACTAATTTCTCAAACAACG
ATAAAAACGCGTGCATAGCGCGATACTGCTCGTAGTCCAACATTTTCATTGCGTCTAACACTTTGGTGACGAAACCAGCGTCATGTAGCAACAGTAAAAT
CCGGTTGATCTCGTCCAGAATGTTAAACGCTACCGCCGGAGGGGGTATCGGACCTTGGATCACTCCGATCAGCTTGGGCTTCAGAATCCGGAGAGCTGGG
TCACTTGATAGTAGATCGTTGAGTGTCTTCTAGTATAACCTCTTTACCAACTGATCCAGCTGCCAGTCATCCATCTTCATATTGTTGTCCACAAACTCGA
TCGTTCGATTAATCGATTTCAAGCTGCAATCGTGCTGATCCGATCTTGTCGCTTCTTTCTTAACCCGTGCTTTCTTCACGTTATTCATCTTTGAATTTGC
TCCAGTGGTCCTGGGTGATAGCTGTTCGGTTTTATCCGAAGGATTTACATCCAGCGGATCGGGCTTTGCAGCATGTTCCGCGGTGTCTCCGAAGGGACCT
CAGAAGGGGGTTGAAGTTTTTCTTCCAGATCGATCGATCTTCCTCTTTGATTTTCGTGTCATCATAGCCCCTCCCAAATCTCCGATTATCTGGAGATCCG
TTAAAATCACGCGTTTGCGGCAATCCCTATGCGTCTGACGGCTTAATCCCAGGTTTAGTCTTGATCCTGACATCTTCTCCAAGGGACTCCCGGTGAAACT
CCGAGTCACCAGAAGATCCGGTCAAGCGCACCAGTGTGGTGGAGTGGCGATCGCTCATTTTCTGAGACGATCCTGAATATCTCCTAACGCCCAGACGACC
AACTAACGGACGGGGTACTCCATTACCGTGCTTGATTCCTTTATCACCTTGTGTACCCGTCGGTAGGGGCAGGCTGCACTCTTCTCGGTGGACTTGTG