Description :
From Genome Similarity Track
Location :
Scaffold_57:69681- 74067
Sequence
4386 bases(100 bases per row)
CCCCGTTCTTCGTAATGATCACGACTATTGGTGACGCCAACGGCGATGTCAAAGGTCGATTAATCTTGGCTGACAACAACCCCTATATCAAATCGGCCAA
CTTCTCACGAAATTTTGGCGCAACCGGTCGTACACGCTGCCCGATTCCCCTCGCTCAGCCAACATCGATATAGCAAACGGTCCCGCGTGCTGCAGGGAGA
AACGCATTCGTTTTGTTAATCAACAAATGACAACTCTTCTACATCGGTTTTCTCAGATTCTTCGATCATCGTCTAATGGTATCCCATGATCGCCCACTTG
GACATTGTCTATCATTCTCTCCATCGTAGAAGTTATCACCTCCGACAGTACAGCCATAAGTTGCTCTACATCTTCCGCTAACTAATAATTCTCTTCGTGA
TAATAAATTGATGCAGCTGAAGATTTCTCTTTCATCGTTTCCCCCTCAATCGCGGCAGCCTTCGCCGTTTCGACCTGTCGCTCGGACCGCCCATGTACTG
CCTGATCCTCGACCTTGATCCCGTCCGTCTGATAGCTGGACCGCCCTTGTAGTTAATCAGTGATCATATGATCGATCTCCTGTGATAAGGCCTCCTTAGC
AACCCCGATTACTTCATTCGATCGTTCTGGGGTCCTCCACACTGCGTTGACCTCACAATTCCTTTGTCGATCTCCGATCCTTGCTTTTGCTAATCTTCCT
TCCGGTTTACTCGTCTAGAATCTCGTCATCAGTGTTACAGTCATGTTCAGATCGCGATGTGATCGCTCTAGAAACCTTGACGTCCTTTGATTCCTTCTTT
GGTCGGATGAAAATTCGGGTGGGTTTCTCTTACGCTGGATGATCAACCAGTGGTACCGCATATGCTATAATCTCTTATTCTTCTCGATCTAAGTTAGCTT
AAAATGCCAATGTTTGCCATTCCATATACCGCTGCGATCCAACAAATACATATCCCTGTGATCGCAGTATCATATCCGCTGTCATCCACAACGCTAGCGG
AGCCCTGTAATTTAAACACACATCGCGATTACATATATTCGTAAGCTGCAGAAACATTATCTTGCCAGTTTCATTTGTCACTGTTGGAACTCACGCCACA
TCCCGCCTCACCCAAAGTTTGGACTTGGGAGGATTAACGCCGACCCTGACTTCAGTCAGTCTACCGGCAGGGATGACAATATGTTGATACTTGAAGTTGA
TCGCCGATATTTTCGATCGGTATGGCGGTCTCCGCCCAGCCAAACAGATGTGAACTTTGGCCGTAAGACACAGGGTTCCGCAGGCCAAATCCAAACGGAT
GTCTGCCGGAACTATGAAGCCCATACCCAGTATGGCTTTTTGACCAACTTGATCACCAACACATCGTCAAAAAGTATACTAGCGATCCGTCCAATGTGAT
TTTGATCTTGGTCCTCCCTATCGTCATGTAGGCATTCTCCCCTATCCCAACAATTTCTCGCGTCTGGCTCTCGTCGATAACACATCGTACCTTACGGGCA
AAGGTTGTGTCGATAATCGGAATTCAGCACTATAGTCGAACAGCATTGTGAACTTTTCTTTATTGAATTTGCCCACTCATTTCGCTTGCTTGAACCGTTT
TGCCGGGGTGTGATACCCCCAGTATCCGCGTGATCCTTCTGGGGCGAGCTCGAGCTCCAACTTTACAGGAATACGAGCATATTCGTCCACTTATGTCACA
CTTGATACGGAAGAGACACATGTAGAACGATCACGTATATTAGTGACCGGATAGCTCCAATTCTTAACACCTTGATCCTCTAATCGTCTTTCAACAAATG
CACATATGCATAGCCTAGAACGCTCGGCTCGTGCCAGATTCCAAACTGGCGAGCTTCCTAGCTTCACATTTCCTTGGCCTTCAGAGAAAACATCCCAGCA
TGCTTGGCGGGCACGTACCACTTGCTGACCAAGTTGTAGAATTCTTTCATGGGGCACTTTCCACCCTCATGCATCTCTCCACAAGCTTCACACACATAGA
AACACTTTCCCGATGGATATCCCTTGCGACCGCATATCTGACACGTCAATTTCTGCCAGAATCCACAATCGTCGTGTTTCTATGATCCGCAATGAGTGCA
GGCTTTATTAACCGTGGCACGATCCGAACTGTAATCTTGACTATTCTTATCGGGTGCAGTACGTTGATCTACGATTGTCGTCGTGCGATCCGAGGTAGCG
ACCACTACCACATTTCGTAGTACTCTTTCAACGTCCGGTGCTCTGAGATCATAGTCTGAATAACTTTTACAATCCTCCACGAGAATGTCCCTCACAGGAC
GTGCTAGTTTTGCTGGTGTTTAGGAACCGTGGGCGCAGATCGTGGTCAAAATTTATCCGATCACATAAATGCTTAAGCTTGTCGATTCTCCATGCGCTTG
AAAGCGCGTAAGGTCTCATACATCTTATCCGCCGCCCTGGTCCTTAACAGCATCAGTTGCTTGGTCAGGGTCCCAGTAAAATGTTCCACATGTTCACGAC
GTATGTCTGGGGATCCCCCTCGAATTCCTATCTTTGCTCTATTTGCTGCCACATCCAAACGATACGGATAGTTCAGAGGCATTACTTCCGGTCGCTTCTT
GGCCAGGTAATATTGTCTTCAAACAGACAAACCATTCTTTCCATAGTGCACGAGAAAACTTTTCAACAGGTCCTACCCTGAATGATGTGTGGATCGGCTT
AGCTGACTGTGCCAATTTTGCGCAGGACCTGTAAGCAGATTCTCAAAAACCAAGCACTTCTCCACATCTGGAGCCTGATAACGTAAGAACGCAGACTTGA
CCTTGTCGATCCAGCTTGTGCCTCGATCTTCATCTTTGTCCTTTCCATTGAACTCGTTCAGTTCTGCGATCGCATACATCCAATTTTGCGTGGTGCGAAG
TCGACCACCTGGTGCGGTCTCCGCAGTTGCCGCGGGTGGTCGTCTCAACTTGTCTTGCCCGAAATCGTCAGAATCTCCTTCTTCACGGTAGTAGATGTCA
GATCTACCGTGCTGAAATCCAAATGGTTTCATCTCAACATCAGGGGTGTATGTCTCGTGACCCTAGCAACCTTGATCCTCTGACTTAAGTATATCGCTTG
GCAGGCTTGGTTACTTTGTTCCTGCTGAAACGATTGCATGGCAGCATCAAAATATGATTGAATTTGTCCTTGGAGTATTCTAACCCGCATCTACTTAAGC
GCGTACTGGTGCAAATCGCGGTCCGCTCTCAGTCCTTTTCCTACGACCACGCAGATCGGGCCTCGTATCCATGCGATCGCGCAGATGGGCATCCCCACTT
GGACCTAAAGACATCCGCTAAATGCCAATTGAGTCCCCTGATTCTACTCAGACTCAGCTGAGTCATTCTATGATGATTTAGTGTGATATCCTCTCCGCAC
TTCCGCAGCCGTCGGTACCACGTGATCGTTCGCTGTTGTCGGTTGCACATGGTCTTTGAAGCTACGTTTTGCCCATCAATAAGACTAATTTCTCAAACAA
CGATAAAAACGCGTGCATAGCGCGATACTGCTCGTAGTCCAACATTTTCATTGCGTCTAACACTTTGGTGACGAAACCAGCGTCATGTAGCAACAGTAAA
ATCCGGTTGATCTCGTCCAGAATGTTAAACGCTACCGCCGGAGGGGGTATCGGACCTTGGATCACTCCGATCAGCTTGGGCTTCAGAATCCGGAGAGCTG
GGTCACTTGATAGTAGATCGTTGAGTGTCTTCTAGTATAACCTCTTTACCAACTGATCCAGCTGCCAGTCATCCATCTTCATATTGTTGTCCACAAACTC
GATCGTTCGATTAATCGATTTCAAGCTGCAATCGTGCTGATCCGATCTTGTCGCTTCTTTCTTAACCCGTGCTTTCTTCACGTTATTCATCTTTGAATTT
GCTCCAGTGGTCCTGGGTGATAGCTGTTCGGTTTTATCCGAAGGATTTACATCCAGCGGATCGGGCTTTGCAGCATGTTCCGCGGTGTCTCCGAAGGGAC
CTCAGAAGGGGGTTGAAGTTTTTCTTCCAGATCGATCGATCTTCCTCTTTGATTTTCGTGTCATCATAGCCCCTCCCAAATCTCCGATTATCTGGAGATC
CGTTAAAATCACGCGTTTGCGGCAATCCCTATGCGTCTGACGGCTTAATCCCAGGTTTAGTCTTGATCCTGACATCTTCTCCAAGGGACTCCCGGTGAAA
CTCCGAGTCACCAGAAGATCCGGTCAAGCGCACCAGTGTGGTGGAGTGGCGATCGCTCATTTTCTGAGACGATCCTGAATATCTCCTAACGCCCAGACGA
CCAACTAACGGACGGGGTACTCCATTACCGTGCTTGATTCCTTTATCACCTTGTGTACCCGTCGGTAGGGGCAGGCTGCACTCTTC