Description :
From Genome Similarity Track
Location :
Scaffold_4:696641- 699478
Sequence
2837 bases(100 bases per row)
TTCAAAAACAAAACAAACAAGCAAACTTTTAACTTGAGGGCTTGGGGGATAAATCGCGGAATGAGAAATACGCTAATGGGCCAATTCCTTGGAAGTGGGT
GCTTCATCGCAGGGAAAAAAGTCTTGTTCAAACGAACGATGCTCGTGTCACTGTCGAGTTGAGCTGATTGGTTTGGCGACAGACACGAGGTTGGGCATCT
TCGGCTAAGAGTGATTGGGTATTGAGCAAATTGACATGTAAAAAAATGCAGACAAGTCATGTTGTTCATCTTCAGCTAAGCTTGGTCGATTATGGCGCAA
ATTGATACACCTTCAGCGAAGCCATGACGCTCTCATACTGTACTAGAGCGTCCGTAAGTGTTTGAATGCAGGTTGTGGTCAATAATAAATGATTAGTATC
AACCTTTGGTAAATAATGTGCATAAATCTTAGCATTTATCGACGGGTACCCGATTCCGGCAGATATTAGCTTAAACATTACAATTAAGAAAGAGAGACCC
GGTTTGGTACCCGGTTTTGGAAAGTTACAAGTTTTTTGCCGGGGCCAAGCACAGGTCTTCGACCTGTGAACAGAACAGCCGCACCATCAATCATGCCCAA
CCCTAAATATGAACGCGGTTCGCATTTTACAGAGTTTTATCAACGGTTATTATGACATGTTCTGGGATAGGAAGCAACGTTAGTGGTGCTATTGCAGACC
AAATAGGATTATACTGGGATAGGAAGCAACGTTAGACCAAATAGGATTATATCCGTGGTACGTCAAGTCAAACGATGACCCCTCCTGACATCTAACTGGT
ATATTTTCTTGAAACCGGTACGACTCCGGTGCCGCACTGGGCCCTCCATCCAAAAGGTTTATATGCGTGGGCAGATCGAACCGGTGTGCTACCGACGACA
CTGGTATGAATCAGTACACAAATTGAGCTGGGTACGGATGGACGAAGTGAAGCAAAGAGAACGATTGAGGCGGACTGTACAATAGCATGCATTTTCTACA
AACTGCAAACAGATCTCAACCAAGTAAAACTGTAGATGCAAGATATCAACCGACAATGCATTACAAAATTAAAAAGCAAACAGGCAAATTTCCGGATAGA
TGCTGTGGCTGCGAAGCAGGCGCAGGAGATGACCGTAGCTAATAAGAAAAGCAATTGATAAAAATAAAAAATAAAAAGAAGGGGTTTATACTAAATCCTC
CTGTCCCAGCCTTCGCGGAACCCTAGTACGGGGCGCTATGTATTTTTAAACTATTTTTTTGCGGTCAACCTTGGTAGCACTCAGGGCGAGCGCGGCATCA
ACGTCGAGTACCCCTCACCCTACACGGCGGGCCAAGATGTGCGTAGGGTAATTAGCAAGGACACTACAGTTGCCGAGTTGGTTGCACTCGGTAATGTAAA
CTACAATCCTTTGTGCTTTGCTCTCATTCTGTCTAAACGAAGGCGTAAATCGTTGTTTTGTATTTTAACTTCATCGTAATTCGTTGTTTTACCATAACCC
AACGACCCTTACTTCGATGGTATTGGATGCTATTCTGTACTGTCGCCCAGGCTTTGATTATCGTTGGAATGGCGCATTTGCAACCGCCAATCCACGATTT
CCCGTGTAAATCAAGCTTAAATCGAGCTTTTCGCTCGCGCATCGCAGGGCAAGTCGCTTACTCAATGATTATTCTAGGATTTGACTTTGAATTAGCCAGC
CTAATCGACTGACAGAATTGGTGAAGAGCACAAATATTATCACGTATTTACAACAGGTCCACAGCTCCTGACAAAGCAAAAGCTTCTAACGACAGCTGAT
GTTCTGACTGAGAGACGGCACCATAGAGCTATAGAGCGGACCGAATCCAGTGGCTGACTGACTGTGTGTACAGTACAGGTATTGTGCACTTGTCAAGGGC
ACGTAAGGTCACTGTACCGCTTTAGTACTTAAATATTTCACTTTCAACTTCATGGATTCGTGCGAGCCTTATCAGGTCTATAATAACCTGAAGGAGGTCC
AGATAAGCCACCACAGCCTGTGGTTCTCGTCCCTGTGGTCACCACAGGGGCGAGAACGCGCAAAGTAACGGCGGTCGGCACGCAAAGCTTCTGACGCCTG
ATCATGGCGCATTATAAGAAGGTAATTTCATCGGCACCCTCTATCCGACGTTTGCTCGACGTACGAGGTTACTAATTACTAGTACATCCGTAGTGTTCGT
ACATCACGACGGCAACGACGTCAGAAGCCTCACTTTGGTCTTATATTGATATATCGATTTATCGAAGGCAATAGGGGAGATTATAAAGTACGAGTCGAGT
TGCGAGTCAGAACGCATAATATTATGAATGTGCGATATAGCCCAGCGTAAACGAGGGAGTGACCCCCACGTTCTACTCGCGTGTGCAGAGCAAAAGAGTG
TGTACCGTAATCGAGTGTTCCACCAAGACAGCAAAGGAGAAAACGTCAAAAGGTGTATGCGTTGGGAAAACGTTTGTCAATAGGTGTAGTGGTCGTGGGC
GTCACGTCGCGTCATGTCTCATCATACACGTACTGACACACGTTTTGGTTGCCGCGGTATTTCGGCCGAGGTCGGGTCATACAGACCCAGGATCGAGCTT
CCATGCACAGTAGTTTATTAACGACACGCTCGTCCGGTTCGTGGTGCCCATGACTTTGATAGCGAATTGTACGACTGAGGGACTACAATGAACGTCGTTA
TCCATTGTAGCCAGGCCTCAGCGTTGCCACAGTTCTATAATACCTACACTCTCCCCCGGTTGGGGGCTCTCACTAGAGCTCCTTCACCTCCGAAATTCAG
ATGCAAAACCTACCTAGTACAGCCATGCTATAGACGC