Description :
From Genome Similarity Track
Location :
Scaffold_437:69664- 71538
Transcript NameFunction/comments
Aphin_H310_05671PREDICTED: WD repeat-containing protein 31

Sequence
1874 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAATGGTGAGTTGACTGTCGAATGCGGACGT
TTGCATGCACTTGCCGCTGTGACTGCGTCATTTCGATTGTCGAAACGCGCCGACGCCATCGGAATACAAGGCCAACTGGGGCAAATCTTGACGATAGAGT
TGGCCGCTACAACGAGTGTGGGCGAGCTTCGACACCAGAACCCCCTGGAAGTCGCTCTGTACGGAATGGGGGCTGCATGCCTCGCGTTCGAAAGGAGAGA
GATGAAAACCTCGATCAGTAAGATTGGATTGAGGATGGCGAACGAGCGATGGTCATAGCACCGGCCAGGAAATTCATTGTGTCGTCGAGTCCAGCCCATC
GTGGCTGCACCTAACGATGGCTTCTGCAATCGGCATTATCCCTTTGCGATCCACTGTCGCAGCGTTTCTACACTAGCTCGAGGCTGCGCTTGGTGCGATC
CCACTCATACATGTCGATGCGACCCGAGAAGGAACTGGCGAGAATGCGGGTCCTTTGATCATCCTTTGAGGCTGGCTCGACGCACGCAAGACTTGTAAAC
ATTCCTATCCACAGCTCACGTTCGAACCACAATACGTGGAGAATCGGAGCTACTGTTCGTACCAGCCCCGCCATCTTGAGTAGAGGCCAAGAGCTCGCCC
GTCATTGTGTTCCACACTCGCACGGAGCTGTCCTTGGACGCTGTAATGCCTTCGTCAGCGCTACAAAGCGTCGGATGAGGAGACGTGCCTGCAGTGACAC
GCCTTGCTTCCATTGAACGCACTGATGCGGAAGAAAAGCGCACGCGGTGGCATCCTGCGAGTGCCCGGTCATTTCGACCACCTGCTTGCCGGTCCGTCGG
TCCCACACGCGGCCTTCGCACCCCACAGCGTTGAATCCCTTGCTGGATGTGAAGACGTAGTGGCCATCCAGCGAGCACGCCATTGCAAGAGGAAAATACA
CGTAGCCTTCGATCGTTTGAGCGGGCGTTTTCCACGTCCGGGCGTCCCAAAAGCGTAGTCGGAGGTCTTCGCCGCCCTGAGCGACAACTTGTGCTTCGGT
GGGCACCCACGCCATGCACGTCACGATGTTTTGAGAGGTGGATGTGTGCTGCATCTGAGTGGCGGTCGCTGCGTCCCATAAAATCACGCTGGTGTCGCGA
CTACCAGACGCGAGCCTGGTTTCCGTTGCTGGGAATGACGATGAGAGGACACCAATGCAGTCGTCGAAAGAAACGTACGGTCAAGAGCCAAGGCAGACAC
AGTGAGCGAGTGGCCTGCAAACGTTGTCGGCGCTGCTGTGCTCAAGGTGTCGATGAGACTGTGACGGACTATCGTGGTATCCCGGGAGCAAGAGTACAAG
CTACAACGAGAAGATTCATCACGATGTGGAGCTCTAGGCAGCGCCATGTAGCTGGCTATCTCACCTGGACGAAC