Description :
From Genome Similarity Track
Location :
contig_10:6966- 9613
Sequence
2647 bases(100 bases per row)
CTGTCGAGGTTTATGCACTAACCCTGAATGACTTGGATTTCTATGCATGACTTCGAGTTTGTATGGCCCCCGAACATGATAAATTGACCGAAAATGGTCG
CGGAGTTTTCATATAGGAAACCCGAGCCAAAAATGGGAGGACACTCACCTCGGAGAAGACCCGGAGCGTTCATATAGGAAAGCCGAGCCAATAAATGGAG
GACACGGAGCACCGGCCTACCCTTCTCCGGTTTGTCTTGATTTCACTATACTGTCCTCTCGTGTATAGGGACCCTCTACCCCATACAAACGCCTTGTCGA
GTAGTCATCGCACGATAGTAATACCATGGAACGGAGCACATTCTGAAACGTAGAGTCCCCATGTTTCAGAGCTCTAACGTTGATATTGAGGAAGTTGTAA
GAAAGTCCATAACGGCTCGTCCGTTGAGAAATAGTAGTACCATTGAACTCCGCACATGTTGAAACGTAGAATCCTACGTTTTCAATGCTCTAACGTTACT
ATTAAAGAAGTGTGTAAAAAGTACAGAGAGGCAAGTCTTTGACACACGCGAGTCGGTGCATTCAATTCGCCATATGTATAAACACGGATTCCCAAGTTTT
CAGCTACTCCTGACGATGGTAGTTTTTCTATCTCCTGATTGGCTAGGAAGCTGTGCTGTCGAGGTTTATGCACTAACCCTGAATGACTTGGATTTCTATG
CATGACTTCGAGTTTGTATGGCCCCCGAACATGATAAATTGACCGAAAATGGTCGCGGAGTTTTCATATAGGAAACCCGAGCCAAAAATGGGAGGACACT
CACCTCGGAGAAGACCCGGAGCGTTCATATAGGAAAGCCGAGCCAATAAATGGAGGACACGGAGCACCGGCCTACCCTTCTCCGGTTTGTCTTGATTTCA
CTATACTGTCCTCTCGTGTATAGGGACCCTCTACCCCATACAAACGCCTTGTCGAGTAGTCATCGCACGATAGTAATACCATGGAACGGAGCACATTCTG
AAACGTAGAGTCCCCATGTTTCAGAGCTCTAACGTTGATATTGAGGAAGTTGTAAGAAAGTCCATAACGGCTCGTCCGTTGAGAAATAGTAGTACCATTG
AACTCCGCACATGTTGAAACGTAGAATCCTACGTTTTCAATGCTCTAACGTTACTATTAAAGAAGTGTGTAAAAAGTACAGAGAGGCAAGTCTTTGACAC
ACGCGAGTCGGTGCATTCAATTCGCCATATGTATAAACACGGATTCCCAAGTTTTCAGCTACTCCTGACGATGGTAGTTTTTCTATCTCCTGATTGGCTA
GGAAGCTGTGCTGTCGAGGTTTATGCACTAACCCTGAATGACTTGGATTTCTATGCATGACTTCGAGTTTGTATGGCCCCCGAACATGATAAATTGACCG
AAAATGGTCGCGGAGTTTTCATATAGGAAACCCGAGCCAAAAATGGGAGGACACTCACCTCGGAGAAGACCCGGAGCGTTCATATAGGAAAGCCGAGCCA
ATAAATGGAGGACACGGAGCACCGGCCTACCCTTCTCCGGTTTGTCTTGATTTCACTATACTGTCCTCTCGTGTATAGGGACCCTCTACCCCATACAAAC
GCCTTGTCGAGTAGTCATCGCACGATAGTAATACCATGGAACGGAGCACATTCTGAAACGTAGAGTCCCCATGTTTCAGAGCTCTAACGTTGATATTGAG
GAAGTTGTAAGAAAGTCCATAACGGCTCGTCCGTTGAGAAATAGTAGTACCATTGAACTCCGCACATGTTGAAACGTAGAATCCTACGTTTTCAATGCTC
TAACGTTACTATTAAAGAAGTGTGTAAAAAGTACAGAGAGGCAAGTCTTTGACACACGCGAGTCGGTGCATTCAATTCGCCATATGTATAAACACGGATT
CCCAAGTTTTCAGCTACTCCTGACGATGGTAGTTTTTCTATCTCCTGATTGGCTAGGAAGCTGTGCTGTCGAGGTTTATGCACTAACCCTGAATGACTTG
GATTTCTATGCATGACTTCGAGTTTGTATGGCCCCCGAACATGATAAATTGACCGAAAATGGTCGCGGAGTTTTCATATAGGAAACCCGAGCCAAAAATG
GGAGGACACTCACCTCGGAGAAGACCCGGAGCGTTCATATAGGAAAGCCGAGCCAATAAATGGAGGACACGGAGCACCGGCCTACCCTTCTCCGGTTTGT
CTTGATTTCACTATACTGTCCTCTCGTGTATAGGGACCCTAAACCCTAACCTAAACCCTAAAGTCTACTTGCTAAACCCTACTATGCAAACCCTTTTTAC
AAACCCTATTTTCACAAAAATGACAATTACCAAATTTATCAACACAAAATTACAATCTTTTCTTTTCTTCTACTACTCACATTACACACATATTGCACCT
TTCACATATACTTCCACCTTTTTACCATCTCCATATCACTTCAATTTACTTTTTCTATCTTTACACACTTTAAATGCAATACTCCTACATACACTTTCCC
CAATTATCGCATCCCCACCTATTCCACTTTCATCACACTGCACATCAACACCTTTCTTACTCTCTATAACCACCACCCCATACTTCTTTCTCATTCACTT
ACTATATATATCTACCCATTCTACTTCTACATACTCTTCATATACAC