Description :
From Genome Similarity Track
Location :
contig_29:696331- 698344
Transcript NameFunction/comments
g5884.t1endo-1,3(4)-beta-glucanase, putative

Sequence
2013 bases(100 bases per row)
CCATCCCCACCAACAATTGGTGGGGCAACATGATCGCGCACGACTCCAATGCCGCCATCCAGCCCATTTGGTCCAACCCGTACTCGCTGCAGATGGTCGC
CGACAAGGCTCCGTTCGGCATGTCCGTCAGTACCCGTACGCAGTCGCTTCAGCGGAGGCAGCTCCGGCAACAACGGCGCCGTCAAGTACTACGCGCACGG
CATGGTTCGCGAGTTCCTGTTCTCGGCCGAGGAGATCGTGTGGCAGAAGCCGAACTTCCAGGTCGTGGACTGGGCCGACCAGGGCGTGACCGTCAAGTTC
GCTGCCAGCTCTTCCAGTGGCAGTATGGTGTCGGACCTGGTCTCCGGAATGGTCTACGCCTCCACCAAGTACTCGGGCCTCACTCCGCGACTTGTGTCGA
GCGCGGTGATCTCCAGTGTTAACGGCCAGTCGCTCGGTGGTCAAGTGCGTGGCTCCAAGTTCGAGATCGTCTACAACTCCGGCCAGAAGTGGGTCGTCTA
CGCGCTGTCGAGTGACGGCCGCAGCGAGAAGGAGATCACGCTGACGGCGGACGGCAACTCCGCTCTCAAGAGCACGGGCGTGTTCGACGGTGTGCTGCGC
GTCGCGCTCGTGCTCGACGACTCGTGGCTGAGCACTCTGGACAAGCACAAGTCCTGTATCGTGCAAGCGGCGAATGTTGATCTCCGTGACGACAGCTCGT
ACTCGTTCAAGTGGAAGACGGTGGGCGATTGCTCCGGCGGTCTCCTGCACTTCGCCATGAAGCACCATGTCGAGACGATTGACAAGAGCAACGGGGTCCG
TCAAGTGGACGGCATGGTGGCGTATTCGACAACCCGCGGGGCTTATCAAGCTTCTTGACGCCAGGCGGCTCAGCCGACCCGGTTTGGGAGATCAAGGAGA
CCCAGCAAGTTCCCGAGGACTTCTACCCAACGCGCAAGGTCGCATCCAGCGTGGCTCAGCAGCAGCGGATCGCCGACCACCTGCGCGAGGACATCAACGG
CGCCTGGTCCATTCCGCTCGACGGCAGCTACTACTTCAACGGCAAGGCTGCGCAGAAGTACGCGTCGCTGTGTCTGATTGCCAACGACGCCGCTGTCGCC
GGAGGAGACAAGAGTCTGCTGAGCACGTGCCTGAACAAGTTGCGCGGCGTGATGGCGCCGTTCGTGACCAACGCCTGGACCAACAAGCTCCAGTACGACC
AGATCTACGGCGGCATCGTCAGCTCGCAGGGCTTCAAGACCAAGGACCTGAACTCGGACTTCGGCAACACCATGTACAACGACCACCACTTCCACTACGG
CTACTGGGTGCACACGGCGGCCATCATGAACCGCCTGGACCCAAGCTGGAGCGACCTGGGCAAGCTCAACGCCATGGTCGACCTGCTGGTGCGCGACGTC
GCCAACTCCGACCCGGCCGACAAGTTCTTCGCGCGCTTCCGCTCCTTCGACTGGCTCCGCGGCCACTCGTACTCGCACGGCGTCACGCCGTTCGCCGATG
GCAAGGACCAGGAGAGCACGTCCGAGGACGTCAACTTCGCCTTCGCCATGTACATGTACGGCAAGGCCACCAAGAACGCCGCCATGGAGGCCGTGGGCAA
GCTCATGACGCGCGTCAACGCGCACGCCATCAAGACGTACTTCCTCATAGAGGACGCGAACCAGGTGCACCCGGCCAACTTCCGCCCCAACAAGGTCACG
GGCATCTTCTTCGACAACAAGGTGGACTACGCCACGTGGTTCAGCGCCGAGAAGTACTGCATCCACGGCATCCAGATGCTCCCCGTGTCGGCCGTCACCG
AGTTCGTGCGCACCAAGCAGTTCGTCAAGGAGGAGTGGGAGCAGGTGCTGGCCAAGGAGACCATCGTCACGCGCGAGGACACGAGCAACTCGTGGCTGTC
GCTGCTGTACATGAACTTCGCCATGGTGGACAAGCAGCGCGCGCTGGGCGTGCTCCAGAAGGCCAAGATGGACGACGGCCTCTCTCGCTCCTGGGCACTG
TACATGGCCGCCA