Description :
From Genome Similarity Track
Location :
Scaffold_110:69612- 77540
Sequence
7928 bases(100 bases per row)
GGTTCTTAATTGCGTAAGTGAACATGAATCGAGAAAAGTCAGCGATGAAGATCAAGAAGTAACGACAACCAGTAAGCTAGGCACAGGTAGTGGATCATAG
ATATCTTAATGGAGTTTTGACAAAGGTGATGTAGCACGTTGTACAGCTCTATTAGAGTAGAATGAGGAGCGGTGTGACTTCGCTAACGTGCAGGCAACAC
AAAAGAAATCTGTCTTTGGACCTAGAGGTATAGATCTATCGAGTCCATGTATGGCTTGGCTCCTAGATAGGTCATTCAAGACACGAACGCTAGGGTGTCC
AAGGCGTTTATGGAAGAGCAGAAAGTAACGTTGCTTACCTGAGGCAATAAAAGCCGCTGGAGATGCCGCTGGTTTGGCTTGGAGCTGATACAGATCCGTG
TTGGTAGCCATAAGCGCTTTGATCTTGAAGCGCTGGTCAGTTTGCATATGGCACTGTTTGCGGTCAAAGTTGAAAAAGCAAAAGTCGTCGTGCTTCACAG
ACGCTGGAATTGATAGCAGCCTGAATTGGAGCTGGGGAGCATACAGAACGCCATGAAGAATAAGCTTCTGCATAGTGCCCTTGGAGTCAGTGACTTCCAG
AACGACCCGTTCAATGCTTCGATGGGGATTTAGTTATTACCACCAACCGTAGTTGAGCCACCACTGGACGTGATGTCGGTGAGCCACTGCGATTCATGGG
TGACGTGGCGAGTGCAGCCAGAGTCGATTGTCCAGGTGGGGTCGGGTTCTACCTTGGCTTGAGCGGTGAGGCTAAATGGGAGATTGACTGTGGTAGCAAC
AGCGATGAGACCGGTGTCACGACGTCCTTGGCGAGCTACATTGCGGCTGTTCCAGAATCACTGTCGTTGTCTTCTTTCTCGTCATTGTCTGACTCAAGAT
AGCGGTCCTTGTCGCGATCTTGGCCGCGTTGTTTGTCGCCATTTCCATGCTTGTCCTCGCCACTACCGCTGTCGCCCTTGAATTCGCGGTTGTTGTTATT
CTTGCCATGTCGTCCATTGCCACCTTCGCTCGAGTCCTGGTACGGGTGATCGCGTTTCGAGTTACCCTTGAAGACGAAGTGAGCAGGATGCACTATCTCA
GCCTTTACTCGTCCATCTCGCCGATCTTTTGGAGGCCTCGGCATTGACGAATGCTGTGGCGTGGGCGATCACGGTAGGAGCAGACATTGGCGTTGTTACG
GCCTTGAGCGTGTGACACAGGAGGTCCGATAGTCACTAGAGCTCTCTCACCCTTGATTGCAAAGGTATATGATGTGCCCTTGGCCAAGGTGTAGCGCTCT
TAAGCTTGAAGATCGCGAACCTTGACATCATGCTCTGTTTAAGGTCTTCAAACGGGATATACTTCCGCTGGCCCTTCCAGATGTGTCCTTCCACGACTTA
AGTATCGAGTGCAACAGGTAGATATACTTCTGTCCCTCGGTCATCACCTATTCGGTGGCTTCTGACACTGCTTTCATCGCGTTCTCAAGCTTGAGAAAGA
ACTCGGTTAAGTCGGAGCCTTCCTCATACTTGATTTTCATTAAGTAGTGTTGAGTGAAGTACGGATCACCATCAAAGGCGGCTGCCTCGTACGTCTGGCA
AATGTAGTTGAATATCGTGTAGGATGTCGTGAGATTCTTGACCAGCCGCGCGTGCATGTTGTCCATCGTTTTCATCAAGAAGGCTTTGGTTCTGGCTTCT
TGTCGACAGCGTTCGCGCTGGCTAAGAGACTGGGGCTTCTCTTTCTTGGCTCGTTTGCGTGCACGGCGAGCCTCGCGCTGGTTAAATAGTCGAGCAACCG
GGAGGTCCTTTCTCTTGATTGACGTATTGGAGCTGGCACCAGAGTCTTCATCCGAGATCGAGGGCGGCTTGAGCTCGTCGTCGCTCTCGTCGTAGTCCAC
AGTGTTGGAGTCGATTTCAACGTTCTTAGTAGCGTTGGCATGCGGTTCATCGTTGGCGTTAGACATATCGCTGCCGCTGTCTTCACTCTCGTCTTCAGAC
GCACCATTGTAGTCAAGCTGCTTCACGTAGCCGAGTAGATGCTTGCCATCTAGTGCTGCGCACACACGGGTCTTCCAGACATCGAAGTTCTCGGCGCCGA
TGAGGCTAGGGAAGTTGTCGCCCGAGGCTTGAGGTAGAGAAGAAGAAGATAGAAGAAGAAGCTACGTATTGGCGTTAAAAGACGAAGTGAGCACTTTATT
AGTCTTAGGAAGCCACTAGTAGCTGCACACCAGTCATTAGTGCTAGTATAGTCTAAGCCAGTCATAACGGCTTAAGTAGGACCTCCTACATTTCATTATA
ATATCTTAGTGAAAAGAGATTCTTTCAAGAAAATCATACTGTTTAGAGGTTACTTCAACAAGCTGGTAAGACATGCCGGGCCGTTTTTATTGTGTCTTTA
GGTCTACTATCTAGGCAGCAACGAGGAATATGTTAGGGATACAGATTGCTCTACAGAAAGCTAACATCAACTGCTCCAAACTTGAGTTTAAGCATGATGT
CCCAAGTGTTTTAAGATTTTATTCGTTATCATAACATAATTCCGACGCCGTTATCCCGAAAACCCTGTCGGAACTGGACCGTTTTTTTGGGCCAATACAC
GTCAGTTGAGAGACTTAAACGAGTCTGATTAGATTCTAGCTGCTCTCTGTTTTGCTAGAAGCAGCAGATTTATTCTAATGTCGGCGTACTTCGACCCACA
GTAAGTGCATTCAGGACATGTTAAAAAATAGCCGTCAGGGTATTCTACGCATACCGGATTTTAAGTTTTTGGCTGCTATTTTGAAACGACCCAGATTGTA
CTAAAGTCGCCGTATACCCTACTTGAGTGGGTTCTAACTCCAGCATTCAGGGAAATTATGAGTTGAACACTTTAAAAACATGTAGTAGACGATAAAAACT
CAAAACTTTTCCGATAAGGTAAACTGCCAGTTTAAGTCAATCGAATCAGATTAAGACCTACCAATAGCAGTACAGATGCAGTGGATTGTCTATAATCAGA
AAGGCAGACGATTCTACTTATACCTCCCAGTTTCGATCTCGCTTCCAACCGCTTCCAACCATGAAGTGCCGCAAGACTTACAGCAAGGAGAAGATGGACT
TCGTAAAGTCAATTCGAGAAGGAGGCGACATTGACGGCATAGGGAGGCAAACTGGCATTCCTGTCCGAAACTTGCGTCGATGGGTTGATGAAGACAAAAA
ATGGCGTGAAGTGGGGAATGACGAGCCTTACTCGTTTAGAAAACGACGTGGGCCAGCGCCTGCTCTATCCAGGGAAGCTGAAACCAATATGCATGAATGG
TGCGTTGGCCAGCAGGTTGATGGGGCTCCTGTTGGAAGGAAAGATATCATACGGAAAGCCCAGCAGATTTCTAAGTTGGCTAATGATCAATTAGTAGTCG
AGGGATGGTATCGCCGATTCAAGGACCGTTATCCTGACTTAAGATCTCGGACTTCTCAGTCAGTGTCAAAGGTTCGCAATAATGTGACTGAATTGGAGGT
GGCTGCACTTTTTAGGTCGTTGGCAAAGGTCATTGTGAAAGAAAATAGGTGGTGGAAGCCGCATCTACAATACTGAAGAAACTGCATTTGAGAGCTCCCG
TAAAAGAACTGATGTGGTAGCTCTTAAAGGGTCGAAAAGCGTTTGGCAGGCTGATTCCACGACAAGCTTCCATCTCTCTATCGTGGCGTGTGGCAGCGCT
AGTGGGTTTGTCGTGCCACCGTAGTTCATATTACCTAGCGAACGAGTGGAAACGGAAGTCCGCAAACTGTGCAGTGTTCCTGAGGCAGCAGTTACTACTG
CTACAAAGGGATTTATGACAGCGTCTCTTTTTGCTAAATGGATTAATTTCTTCGCTTTTTCTGTGTCAAAACGTCACTAGCTCTCGTCATGGATGGCTGC
ACATCTCATATTACTGACGAAATCGTCATAGCCGCTGATCGGATGCTTGTCAAACTGGTGTGCCTCCCTGCAAACGGCACACACTTACTGCATCCGTTAG
ATGTTGCGTTTTTTTTTCATTTAGAACACATTTCGCGATCTCATCGACGCGGTGGTTTGTGCGAGCGGAACTAATACTATCAGCAGGAAAAAGCTCTTCA
AATGGCTACATTAGCATGGACAAGTTGCAACTTCGAGCAAGATATTTCTTCTGCCTTTCGGAGCTGTGGGATTTTCCCGTTGAATCTTGTAAAAATGCAC
GAGAAACTCCACAACTACCAACACAACGGTGTTTCTGCCAGCCTTAAAACAGCTTCCTGATTAAGATACAAGGAAACAGTGTCACGACATCTTACTGCTA
TCTGCTCGTCAACGCAAGCAGAGTAGAAAACGAAAAACAAAGACAGTAGCAGGTAGACTGCTAGCACGCGAGATGCTCCAGCAACCGGACCAACACTCCG
AGCCAATGACCCAGAGCCAAAAACGATACACAGCGAAGAGTAGGAGAGCTACAAAAAAAACCGTCGAGAGGATAGTACCTCGAGGAGCAGAAGCAGGAGC
AGGAGCACGACCACCAGCGCGTACAGACCCAGGACCAGGGGTATGAGCTGGAGCTGAATGCAGAAGTGTCGGCCCAACAAAGCAGCGAAGCCGAAACAGT
TATGTATGTCGTAAGGTTGTAGATGTTTTTTTTAATACACTCCATTCTTTGATCGTACTCGTGATTATCATTTTATAAGGCTAAAATCGAAATTTGCAGA
AATTCCAGTGTACGTTTGAGATCGTGCGTAAAACGTCGTCGTCTTTACTAAACTCAAGTCAACTTTGGACTTAAGCTGGCACATCTGCAAAATGGGCCCA
AACTTTAGGCCGCTACTACAAACTAAAAATAGCTCGTTCGCGTTGCTTCGCACCACAAGACAATGTTGAAATCCTGATGGTTACAGACGTGTTTGTAAAA
TGATCGCTTTCGATTCCGATGGCAATTTACGCGCTCTCAAACTCAACCTTCTGTCACGGACTTAAACTGGCAGCTTACCTTAATATTGAAAGAGTTTTGA
GTTTTTCTTATCTCCCTGAGACCGCGCAAAACAAAATGATACCTAGACGGAACTCGTTAGACAAGTGTCAGACAAATGAATTTGTATTAAATTGGAGAGG
TGGGTACAAACGCTGAATAGATGGGTACAAAAGAGAAGTGGTGTGCAACATCGCTCTCTTTGGTGTGTGACGTTAACGAGCTGTTGTTTTTGCTTTCTTT
CTTAGCAGTTTTTCTACTGTCGCCCAACTGAGCTGCCCGCGACGTCGTTTGCGTGACTTCTCAGTAGTTTCGTCAACAGCGACGCTGGTTAAGCACCTGA
GTAGCGCCATCGATGGTATGGCTGCGACTGAGCAGAACTTTCGATGCAGCATTGCTCTCAATCTTGAGCATCAGGTAACGGAGCTGACTCAGACGCTTTT
GAATCATCCTGCTTGGCATATCGCGGCCGTCAGGTAAGCGAAGCGACGGTACCTGCTTAGCCTTGTTACCACACATCCAAAGCACCCATACATGACGAAC
TGAGCTATCGGTGACAGTAAAATCAGCGGGTACATAACGAACGGAGCAATCGGGGACAGTAAAATCAGCGGGTACACGACGAAATTTTCCCTCGCAGTAG
TGATAGAGATGGCGACTGCTATCTTCAGTGGCACTGTCGACGACAGGATCATGTCCGCTTGTTAGCTTCTCTACAAAATCGTCAACGCCAGTATCGTGAA
GACACGCTCTAATTGCATCATGAAAACCGTCGTATGTAACAGTACCGGTACCGATAGCACGTTTCTCCAGCTCAGATATAATGTCCTGCACAGTATCAAC
TCGCGTAGCTTCAGGTTTTTGCTAGCGCGTCAAGCCGCCCGTCCTTCAGACCTTTCATTTCACACAGTATCGAGACATGGGGTGGTACTTCTGTTGGGCG
AATACGAGCTTCAGTGCACCCATCACATGTCCTAATTCGGTCTGTCAGGCCTGATAGTAGATCTCCATCTTGGAAAAATAGGCGTCTCAAAAATGTGGTG
CTGTGGAGAGAGAGTATCGTTCAGGAATGACGAATGGTAGACCAACGATGCTAATCAGTACTCCGCGATGTACTCGAGCTTTTAGGTAGGGCTCGAAACA
TCATTTTCATCCCGATCTCAGCACCCTCGTCGCGTGAATCGAAATGTGGAGCTAAGGTCGAGAGCTTGTAGCTTTAAGTAGGAAGATCTGCAGCTGTACG
ACCCACGTGCATGTCGTCAGCAGCCTCGTAGCGAAGATATGTGTTCTGTACCCTCCGAGCGACCAGCAAATGGAGGGCAGTAGACGGTGGGCGTGCAGTT
GACCCTGAAGAGCAGAACGTGGCTGAGCCTTTTCGCATTGAGTGAGTCCCCAGTTCGGTGGCGTTAAGACTCTGACGCTGCAATTCGGTGGCTACATCCT
CGTGTCCAATAGACGCAGCCAACACTTTCTAAAGCGCTCGTACTGGCTGCTGCCGGGGAAAAGTAGGTCACTACGTCAAAATTTGAACCGACCAATATAG
TCCTAAAGCGAGGAATAGGACCAATACTTGGCTGTAGCGGGTTGGCGTAGATATGACGAGAGTCACGCAGTTATTTACCACCTTGGTCGTTCTTCATATG
AGCGAAGTAAATCTGTAGCGCATCGCCTCTCCACTCCATATGTGAATGGCGTATTTTAAATGCGTTGGAGGAGCGGCACATGAGATTCCAAGCAATTATC
ATGTATGTGTAGCAAAAGCCATCTCCTTGCCTGCATGAGTGAGCTTTTTTTTGCACAGGAAGGAGTACAGATCAAACATGAGCGGATCCTTACCAGTCAT
GACGGAGGTCTCACCATTAGCTGCGTCCTTCGCAAGTTTATGCTTGAGCCCTTTGAAGTGGTTTGTGAGCTCTGACTCTAAGCGCTTGGGCTTGGTGTGG
CCGTAGTTACGAAACAAGTTAAACAGCCCTGTCCGATGCATGTTCAGAGCGGAGTAGCTTAGGGTACTGCCATCCTTTCGCGCTAGCGTCACAAGCCATG
TAACAAAGTCAGATGCGTCTAATGCCGCAAAGTCCAGTGGGGGAATACTGCGGCTCTGAAAAACAAATTCTTTGATACAAGAGCGTAGTTGTTGCAGCGA
GCACTCCGTGATATCACCAAGGCCCTCGAGAAGGGGCCTGGGTGCGAGATGCGGTTTGTGGCGGGTAACCCACGCCAGAAAACGACTGTAAGAGTTCTGA
TAAGTGGCTCTTGAGCGTGCAGTCACTGTGTTATCGCGGATATCGCGACCTGTTTGCTTTAACGTTTGCCAATCGTAGCCTTCCATTTCCGGCTCGACAT
GCGGTCTGACTTCTTCGGGGCGAATTGCGATTTGCTGTTAGTGTACTACAAAACAAAACAGGGGAGAGAATTGAGATCTTAGAAAATGTCAGACCTTCTG
TCTAACGCAAACACTTGTGTGTCCCACATTGTCATACAAATTTTGGGGAATGATACTTACGAACCATTTAGAGTTGTCGAGATAATCGAGCTTAAAGTTG
GCCAATTGATTTCGCACATAACCGGAACTGTAACATTTGGCGTAAACTTCCATCGAAAAAACTGTAAAACTATTAATACCCTTATTCAATTGCTTTTAAC
AAGGGCTTTTAAATAACACTTGATTTTTTTAAGTAAAAAAATATTGAGCTCACAACACTCCTAAATGTATCGTCATTTCGAGGGCCCATAAATGGAGATA
ATATTTTTGTGCGAGCACAACTTCTTCAGATTTAAGCATTCTGTACCTTTTAAGGGTCCAAGAGATGGCTTAAATCGCGATTCGTACTTAGGTTCGTAAG
TGTCATTTTGTTTTGCGCGGTCTCAGTTTTTTTTTAAAAACAATACTTCCACAAGTCTTAAAAATATCAAAGGGGTTTGAAATGATCATTTTAATTAATT
TGAAAGGGAGCTTTTATTTGGGTGAGTT