Description :
From Genome Similarity Track
Location :
Scaffold_525:696- 4822
Sequence
4126 bases(100 bases per row)
GGCACTCTGGTTGAATTCATACAGAAGCGCACCACAATTGAGCCTGGTCACTGGTAACCACTCAGGATCATCGTATCCTTTCCACTTGATCAGGTACTCG
CGGAATCTCTTGGAAGTACGAGTGCGCTTGGCCCACCGGAGGTCCAGAATCTTTTCCACTTCGTACTCATCATTCTGTTCGTCCGGCTCCCAGCAGTCCT
CGGGCAGCAGGGCTGCATCGAAATCGTCGTCATCATCCAGTTCGAGTTCCGCGGTAGGTCGCTTCGGAAACAGAGCGCGAGGCTTGAGGCGGCAGATGTG
TACCCAGGGGTTAACACGATATCCTGCGTCCTCCACCTTGAGTTTCACTCTGAAGTCATCGTGTACCTCTTCGATCCTGAACGGCCCATGCCACATGTGA
GCCAGCTTGCGGCTCAATCCGGTCTGGACTTTCGGGATGTAGAGCCATACCGTATCACCCTTCTCAAATCCTGTCTTCAGCCTCTCGGACAATTCTCTCC
ACTTGCTTGTCTGTTCTTCCGATCGTGTTCGCTTCGCTTGTCTCGGGAGGTCCTCGGCACAGGCTATTGCGTAGCTGTAGTCGCGCTGAAATTTCCGACG
CCACTCGTACGCAGTGCGTTCAGGCACACTTGATGGTTTCGGTCCTAACATCGCCGACACCGTGCCTTGCGCATCCCAACCGTGTACCAGATAGAATGGA
GTATCCAATCGGGTCGCGTCGAACGAGGTGTTGAGGGCGAACATCAGTCGCTCAGCGTGATCGTCCCAGTCAGACTGGTCAGACTCAGCGATGTAAGTGC
GGACGCTCCGGATGACGGTCTGCACCGAACGTTCCTGTTGGCCGTTCGCTTGAGGACGATATGCCAACGTGGCGCGCTGACGACTGCCGAGTAGCTCCCG
AAACCGAGTGAAGACCTCACTCATGAAACGTGGGTCTTGATCGTGTCTGATCATTGACGACGCACCGAAATTCCAGAAGACTCGCTCTTCATAGGCCTCT
GCTACATCCTGTGCCGTAGTAGACGACATGGGTTTACACATCACGTAACCAGAGAATGAATCCTGAAAAAGCAGTAGGAAGGTGTTCCCTCGTGCCGACT
TGGGCATGTGCGTCACAAAATCCATCGACACAACTTCAAACGGGCGCCTGGGCTCGATGTTACCAGGTGACGGTCCAGGGTTGGGAGGTCGCCCCTTTCC
ACTTGCACAGTCAACGCACTCCTTCACGAAACGTTCCACGTCGGCACACATTCCGGGCCAGTAGAACTCGGAGCGTAACCGCTCGTGGGTGCGGGTAATT
CCCTGGTGTCCACCTTGAAAGTCCTCGTGAGCGTAATGCAGCAAGTCAGCGTGCAGGGTTTGTGGCACCACAAGACGTGGCTCATCCTGTACGTCCCGAG
GTCGATCTCGAGTAGACCGCGCGAGTCCATACAGGATGCCTCTGGCATCCAGTGCAAACAAGTCCGAGAGCTTCGCGATCTTGCGAAGCCGCCTCGGAGA
GAATCGATCCAGGTCGCCACTCAGATACGCTTTGACTTCCGAAATGAACTCATCCCGATCCTGGTGTGCCTTAATCCTGCGCCACCTCTCGGCTTGGAAC
TCCAACGGACCCAATGGGCCACTCGACTCTGTCTCCTCCTGTGTTCTCGATCAGGTCAGGACCGCCATGACTCGAGCACAGTGAGGTAACGGAGCAGAAC
CGGGGTCCTGTTCGACATCGTCTGGTGACCCCACATCCGGTGTCACCACCTTCTTAGCAGCCGATCCATCTGGTGCATCCTGAACTCCCTCACTCACATC
CTGCGCCACAACCACTGGCTTCATCAGCTTTTCGTGGATCTTTGACACTCGCTGCAGATGGATTCGTTCCTCTTCATCCTGTAGTCCACGTGATACCCAG
CGCCAGCGTCTTGGAGGTCAGGTAGTCCGCGGCCGAATTGTATTCACGTTTCACATGAACGAGCCGAAGCGTACTGAATCGTCCTTCCAGAGTTTTGCAC
CGAGCCAGATGTCGTTGAAGGTTGGGTTGGTTGCAGTTAATCAGCTCTTGGACTTGTTGTATCACAATGCGAGAGTCTCCAACCACGGTCAGGTCTTGAA
CGCCCCGACCAGTGCCATGGTCAGTCCATTCAGTAAGCCGTGATATTCTGCATCGTTCACAGTGACATCACTCAGGATGAAACCTTGTGCATCGAGTACG
CTCCAACAAGGCAGGCTCCACAGGATGCATCCGCAGCTTCCTTGGCGAGTCGACGTCTTGGCTGCTCCATCGAAGCTTACCACAATCCCCTCAAAGTTAG
CGTCCAACATCTCCATGCTCACCACCGGTGGTGGCTTGACCCGCCCCTTGACTGGAATCAGCAACTCTGCGATCCGGTCCAAGTGCTCTCTGGGGGTGAT
ACCCGCACCGAGTATAGCGGCTAGACCGTCTTCATCTCGCTTTGCGAACTTCTCGCTGAATTCGGCGAACTTCCAGGTCCCACTGGGAAAGAGTGACGCC
CCATGGTACGCAACGTCCATCCGCCGACTTGGACTGAATCACCCACTTGAGTACCGAATAGCGGGTGTACACGATTATCAAACATCCTTCCAGGATCGTC
CTGAATACATCCAGTACTCTCATGATCGCGATGACTTCCTTCTCCGCAACATGATATCGGACTTCCGAGTCATTCAGTACACGCCCCGTGAAACGGACGG
GCTGAATCAGTCCGTCATGCTCTTGACCGAGGACTGCACAGGCTGCCCACTGGTTCGCGTGAGGAATGATGACGAACGGCTTGGTCCGGTCCGAATGACG
TAGCAATGGGGTCGACACGATCTTTCGCTTCAGGATCTCGAACGCTTCCTTCGCCCTCGACAAGTCCCTACCGGATCGCACTTGGTCGTCGCTCAGCTCG
TACAGGACTGCAGCTACCACCGGGAAATCCTCTATGAACTTGTGGTAGTAGTTCAGACTGCCGAGGAAGGACTGGATCCCCATCAGAGTAGACGGGAATG
GTAGATCCAGTACGCCCTTAGCGATCTTCGGCGTCGCCCTGAGTCCTTCTGCACTGATTTCATGAGAGAGATACGGGATCGAGCGCTTACCGAATTCACT
CTTCGGTAGACTGACAGAGATGTTCCAATACCGCAACCGAAACAGTAGCGCATCCAGATCGATGCAAAGTTGATCCCACGTAGGCGCCCCATGCGCGATG
TCGTCAATGTACGAGCTCCGTCCTAGGACAGGGCCCATCTGCATCGGCGCCGGGATGTTACGTTGGAACACAGTCATCTGGTCTGTCAGCGCGGGTAGAC
GTCGACCAGACAGGATTTCGTCGTCTGATCCGGTGTCGCTCCCTGCGACGTTGTCCTCTTGCGGCTTAAAACCCAGATAATCCAGTACGTCCTGATCCAC
CTGAGCTTCCTTACCAGGTGGTAGTCGAACAAAGCCCCACAGACAGTTGTTGAGCATCTGCTGGTACACCAGCGGAGCATTCTTCAGACCAAATGGCATG
CGTCGCCACTGGTAGTAACCGAATGGCGACACGAACGCCGAGATGAGCTTGGCTCGCTTCGTCATCCTGATCGCCCAGAAGCCGCTGGCCATGTCCAGAC
TCATAAACCACATCGCGCTCTCGAACCCGATTAGCAGGTCGTCAATGAGCGGGAGAGGATAGTTGGACAACTGGATGAACACGTCCACGATCCGGTAATC
AATGCACATCCGGATGTCGACCTCGTTCTTCTTCAGTACCATCACGATCGGTGACGCCCAGGGTGACGTAGATGTCTCGATCAATCCAGTCTCCAACAAC
TTCTTCAGCAACTCGTACACCTTCATCGCAAGGTGTGGCGCGACCGAGCGTGCCCTCTGTGTGACAGGCTTAGCGTCTCCCACATCCAGATCGCAAACGA
CTCCGCGAGCTGGGGCAGGTGCCGCATTTCCATCACCTAAGAAGATACTTCGGTGGTACCTCAGGATGCCACGTAATCGGTGTTCGTCATCCGGCGTGCT
CACGCCAGGTTCGCCAACATCAGCCTTGTCAATGTCGCACTCGGGACTTAAATCCTGCACCTCCGGGAGGAGTGCGAGTTGGTCTCGCAGCTGGGAGAGC
AGATCGCTCCCTTCATGAATGTACAC