Description :
From Genome Similarity Track
Location :
Scaffold_1618:696- 4100
Sequence
3404 bases(100 bases per row)
AACAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATC
AATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCTCTGGGGATGCCCACGGGGACGTCGAGAAACTGATGATCTTGGCTTGCAGCAGG
CCCTTAATCAGGTCCGATAGTTTTTCCCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGA
CTCCGCGGGGAGCGGCGGTAACGCATTTCCTTTACCAATCAGCAGATGTCGGCTCTCCCAGAATTTTCTGTAGGCCAAAAAAAAAACCCCCTTCTCTCTC
TTCCGGGGGTTTCTTTCTCCCCCCGCGATCCCCTGGGAAAAATCTTGCAAGTGGAATTTCTCTTGGGGGTCCAGGGTAACTCGCGGATCACGCCCTGTTC
TTCTCCCGAAACTCCGGGGTGTTAAAATCCGCCTTCACGGTAACGGACTTGCTCTATCTTCCGTCTTCTTAGGATCCACCATGGATCCAAACACGCGGCC
CTCTCTCGCCTGGCAGTCCTTCAATCTTCGGGGGTTCAGGTACCCTGGTATCAGGGAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCC
CGACAGTTCGGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGC
TGCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTGAGGGCCGATTCTGGGGATCGTCCCCCGTCCTGGATCCAACTTCCATTG
CTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCTGGGAGCTCCAC
CTCTGCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTTCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGG
ATAACGTCCTTCGCCAACCATCGCCCGATCTCCTCATGATGGTCCAGTAATAATCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTG
GTCCCTGGATTACGGTCGGCACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACCTTAACTGGTCTGGCCGTTCCCAGGTTTCCCC
GGACTCGATCCATGTTGTCTTATCCGCCCTTATGATCCTCATCTTCGCCCCATTCAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAA
CAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCCGGCACCATAAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGT
CAAACCAATACACCAAACTCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGG
GTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGGATCAAGATCCCTACCTTGGCT
TGTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCACGGGACTCTCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCATAGGATCCAG
TGACCAGACAGACCTTAGGTGGATCTGCAGTGACTTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCATTTCTCCCAATAAACCACGTGCCTCTC
CTCTGTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGAAAACTCATCAACTTGGCGCAAACTAGAGACCTTGGCAACTGACACTTCATGTAGATCACG
TGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGA
TTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTA
GAATTCTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCTACACTTC
TCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAGCACCTGACCTGGGCTGTCCCGTCCATGAGATCTCGGGATC
TGTACATCCCACGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGGCGCAGTGAGACAGACTCGACGGTA
ATCGTTAGGGTCGGAGTCCGAACCGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGA
GCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCATCTGCGTCTG
GAAGACGTAACAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAGTGATTCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTT
GATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCC
CACCGACACTCCCAATCCACAGTACTGGGTCTGGAAGCTGCGCAGCAAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGCTCCT
GGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTTTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTC
GCTGGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTG
TGGCTGTTGCTACCGCTGCTGACGAAGTGGGTGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCAC
GTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGCCGC
TGCA