Description :
From Genome Similarity Track
Location :
Scaffold_1413:696- 3145
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1413-snap-gene-0.5Lectin
Pytul_var.sporangiiferummaker-pug3_contig_1413-fgenesh-gene-0.3Conserved gene of unknown function

Sequence
2449 bases(100 bases per row)
ATNNNNNNNNNNNNNNNNNNNNNNCGCCAAGATCCAATACAAGGACAGCTACGTGGCGATCCTGATCGACGCCAAAAACACGGGCGACTGGGTGCACTGC
TACGNNNNNNNNNNNNNNNNNNGTCGACGATGCCACGATCGGCATCACGGCGTCCACGGGCGGTCTCGCCGACAACCACGACGTCATCGCGCTCAAAGTC
TACGAGTACGTTGCTGCTTTTCCTGTGGCTAGTGATATATGCTGCTCCTACTCAAAATGCTGATGAGTTCCTTTGTATTTGGTATTGCAGTGACGTTGGC
GACATGGCGCACGAAGAGGTCGACCAAAAGGTGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGAAGTACGAGCAGCTCATTGAAGACTTTGAGCACCAGTTCACAGGTAAGAGAGAGTGTGTATGCTGTA
ATACAATGGCTATTGGGCGGTAGACTGACTTTAGCGGCACGATTGCTTTCCCTGCTATCCACTTGCAGCCTTGAAAGAGTCGACGGAGAACACGATCAAG
AAGCTGCGCGAACAGGAGGCCGAAGACACGAAGCGCATTGCGGAGCTGGAGACGTGGGTGAGCAGCAAGGTGAGCGAGCGCGTGGCCACGACCGTGGACG
CGATCCGCGACCAGGTGGACGAGCGGCTGACCAAGACCGTGCAGGAAACGGCCGAGCGCTCGTCGGGCTGGAAGATGCCGTTCTTCGTGCTCGTGCTCGT
GCTCGGCGGCGTCGTCGCGGGCGCGTACAAGAAGTACCAGGACCTGCGCAAGTCGCACTTGCTGTAAATAGCGCTCGCTGCTACAAATCAAATGTGTTTT
GTGGCTCATGCGGTAGGAAATTGCTCGAGTATGTGAACGAGAGCATGCGTGTGTTTGGCGATAATGAAAAAGCACAAAAACAAAAGTTGCATTTACGAAA
AAGCCGTTTACAAATATCGTCACATGAATTCATTCATTATACGGGCGTAGTCTGTCAAAAATGGGGATTGCTATGGTATGGGGTGGGTCTATGTCTATCT
ATTGTACGAACTAAGCGGAGACTTCCTCGAGCTCCATGAGCTCGTCCTGGACGTTCTCGCAGACGCGGCAGATGCAGTACGGGTCGTAGGGCACCGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACCACGTCTTGAACACGTGGTGCTTGGGGTTGATGTTGTCTCGGTGCGCG
AGGAAGAGGATTACCACGGGCGCGAGCAGCGGCGGCTGCACGTTCGTGATGTTGTGCCCCGAGACCACGTACCAGATGGCCTCGACCAGCAATTCCTTTG
CGTACTGGCGCGCGCGATCTTTGAGCAGGAAGAGGTCGGCGAAGTAGTACGCCAGGTACACCTTCTCGGATGAGAGTGGGGTCTCGAGGCTGTGGATCTT
CTTCTGCAGCAAACCCAGCACGGTCGGCGCCATGATGCGGAAGTTGAGCTCCTGGAGGATGTGCGTCTCAAACTCGATGATCTCCTTCCACGTCCACTGT
GATACGATAAAGAGGAAACAACATTAGACTATCGGTCACCATGTACACAGCGAGAGTAGTGCCAGCAATGTAGATTTTATTCTTACGTTGCCCGAGTGCC
GTCGCTGCTGCAGGATCTTCTTGATGGACTTCTCGACGATGCTCGTCGGCGTCTCCATGAACTTGACTGCAATCCACAGGCAACTGCATCATGACAAACA
AACAGAGCACAATGCTATCGCGTTAGTCACTCGCGCAGTATAGCAACATCTTGCATTTCTTTGCTCTTGCACGTACGCAATGCTCAGGGTCTCCAGTCGA
GACGCTTCCAGCGGACGCACTTGCATGTAGCGATCGAGCAGATCCACGCATAAGTGCAATGTCTCTCGCGCGAGTCCGAGCGCCGAGGCGATAGTCAAGA
TCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGTTGCAAACTCCTTCTCGTCGTCCTGCTGCTTGTCCACTTCGTACTCGCTGTC
CTGCTGCGGTTCGCTCACGAGCGGCGACATCTTACACACCGAGCCATGGCACAGGTTGGCTTTTGGGGACGACAGCACGACAGCGACAGGTGTACATGGG
CGGCTGCTGATGGATTTGTGCATCTTCGCAGCATGCACGTCATTGTGCGCTGCGGCAGCAATGGACGGACTTCTTGGTCGCTTGCGCACGAGCAATGGAC
ACATCGTGATGGCTACAGAGAGAGGGACGGGAGTGCTGTGTCACGTGAAACCGCCGGGGCGTGTGNNNNNNNNNNNNNNNNNNNNNAGGGGGCGTCCCAC
CGCTGACTGCTCTCTGTAGCGCAAGAGGAGAAGTGGTTTCTGCTTGTGT